Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16185  (registered. 2002)
Contig Information
Length 905 bp
Clones 67 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 11
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 7
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 8
Wh_oh Pistil at heading date 1
Wh_r Root 7
Wh_yd Spikelet at late flowering 9
Wh_yf Spikelet at early flowering 16
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_12360 [Oryza sativa Indica Group]
Score 675
Evalue 6.28566e-69
Total Hit Count 411
Registered year 2002
Contig Sequence     [ Download ]
>Contig16185
ttttttttttgTTTAACTAGGTTCAAAAGCATAATATAATACCGTGAACCCAAATGTTTTAACAAACTCTGCATCCAACAG*AATAAACACGATATGATA
TTTAAGGTATCTGACACGCTGACACAAACAAG*ATATTGGACAGGAAACAGTTCTGAACTTCTGATGTTCCAAAATTAGGCTAACCCTTCATAGTACCA*
G*AAAGCTAAAGCTTCATGTCA*GAACTTCACTTCTTGGCCTTCTTTGGTGCCGCAGCTGGAGCTGCAGCCGCTGGTGCTGGTGCATGATCTCTCGGGCC
CTGGGCCAATCTCTCCTCCCTCCTGGCAATCTTCCTCTCCCTGCTTGCCTTGCTCTTGGCGCGCTTGGCCTCAAACTGGTCAGAGAGGGTCTTCTCT*CT
TGCCTTCTCAG*CCTTGGACTTGTGGATAC*TCT*CCATGAGGA*CCCT*C*TTGTT*CT*TGAACATGTTACCTTTGACCTTCAG*GTACATGT*CATG
G*TACATGTGCTTGTCGATCTTCTTGGCCTCACGGTACTTGCGCA*GAAGGCGCCTCAGGACGCGCATCCTCCGCATCCACAGGAT*CTTGGTGGGGAGC
CTAGCCT*CCCTGGTACCCCTACGCTTACCATATCCAGA*GTGACGGCCCTTCTGCTTGGCCTCATGTGCCCTCCTTGCACGAGACC*TGGA*GTGGATC
TTCTGAGGCTTCCTGATGATGAAACCATCCTTTACCAGCTTCCGGATGTTCTGCCGGGAGTTGGCCATGGAGAT*CTCGTTGACCTCATTGGGGTCGAGC
CAGACCTTGCCCTTGCCGCATTTGAGGACGCTCGAGGCCAGGCGCTTCTGCAGCTTCAGCGACACCATCTTCGCCGCCGCTCTCCTCCTCCt*cccgTCT
GCCtc
page-top