Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16180  (registered. 2002)
Contig Information
Length 837 bp
Clones 66 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 8
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 15
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 4
Wh_r Root 19
Wh_yd Spikelet at late flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Profilin-1 >gi|1229169|gb|AAA92503.1| profilin [Hordeum vulgare]
Score 433
Evalue 3.98864e-56
Total Hit Count 367
Registered year 2002
Contig Sequence     [ Download ]
>Contig16180
tttttttttttaaaaatgcaatcatcttcaatAAAGCAGCAGCAG*AACCCACAAGTTACCATG*ACGAGGCAAATGTACATTACTCAGCGAAAG*AGCG
GCTGAGTTTGATACGACGCGATGCCAAACATTAAAAAG*AAAACATAGTAAAATCCTTTTTTTTTCCCTTCGACACGTCACCAACCGACAAACCCCAAGC
TAAAATTATTCACTGCATATATCATGCGGTACGCCAA*GCAGATGGATGCAAAGCCCACAGTA*GAGCAAACTTAGTCCCAGACGACCAAAATAACATCA
TATCAGGGCGGGCTTAGAAACCCTGCTCGACCAGGTAGTCGCCGAGCCTCTCCACGACCAAATTGCACTGGCCAGGAGTCATGGGCTCATCGTAGATACC
AAGAATCAGGGCCATGCCGGTCTTCTTGATAGTGATGCCACCGGTGCCCTTCTTTCCTCGGATGACAACCCCAGGTTCACCTTGGATGACCATGTACTTT
GTGCCTCCAAGGAAAAGACCA*GTTGGTGCAAGATGTCCAGGTTCCTCAAAGTCTTTAATGATGCCAGCAATCTCCTCGGGCTTGAACTGGGGG*AAGTT
GGGGGACTGCGCCCAGACGCTGCCCGTCGTGGCCGAGGATGGCGGCGG*AGGT*GAGGTGCT*GGCCGTCGATCTCGCAGCACAGGTGGTCGTCGACGTA
CGTCTGCCACGACATCCTCCTCCTTCT*CCGGCGGCGACTTCT*CTGGGCGGCTGCTGCGGCGGATGCCTGCGTGGAGCGCACGCGGT*CTCGGC*TCGG
CTGGGGATGCTTTGCTTGGACCTGGA*TGTGTCGtgc
page-top