Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16174  (registered. 2002)
Contig Information
Length 640 bp
Clones 65 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 10
Wh_SL Seed DPA30 7
Wh_dL Crown of seedling 9
Wh_e Seed DPA10 11
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 3
Wh_r Root 6
Wh_yd Spikelet at late flowering 9
Wh_yf Spikelet at early flowering 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein P1 [Triticum aestivum]
Score 305
Evalue 2.62784e-26
Total Hit Count 341
Registered year 2002
Contig Sequence     [ Download ]
>Contig16174
ttttgaaagctggggacaacataaccagtaGGGTAAAACAAGCAATGGCTTTTCAACCAAGCACCAAAACCATTTTCATTCTAAAAAGACCATCCCAAGG
*TGGTTTGCAGTACTCATTGCACAG*A*TACTTAGGTCTCAAACATATTAAATCCGCAAAATTCGACCTAAAAGCACATAAGATAAGTAATCCTTAGCAT
AAAAGATTCCACAGGAGAACTGGAATTGAACTGCTTAGTCGAACAAGCTGAAGCCCATGTCATCATCGCTCTCTTCCTTAGCCTCCTCCTTTTTCTCTTC
TTTCTTCTCTTCAGCGGCAGCAGCACCACCAGCAGCCGGGGCAGCAGCAGCAGCAGCTGGAGCACCACCTCCACCAGATCCGACGGAAAGGATGAGGTCA
TCGACGCTCCTCTTCTCCAGGAGCTTGGCGAAGAGCGCGGGCCAGTAGGCCTCAACCTTGATTCCGGCAGCCTTCACCACCGTCG*CGATCTTCTCAGAA
GTGATGGGGATCCCGTCATCGTGGAGGATGAGGGCGGCAAGGGTGCAGGCGACCTCGCTGGAAGACATGGCGA*CGGATT*CTCACCGGAGCAGAT*CTG
CGAT*CTTGGGAGGCGATGGAAGTGGAGGCGCAGGAGgcc
page-top