Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16166  (registered. 2002)
Contig Information
Length 872 bp
Clones 63 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 16
Wh_SL Seed DPA30 12
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 7
Wh_h Spike at heading date 7
Wh_r Root 11
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0565000 [Oryza sativa (japonica cultivar-group)] >gi|50511482|gb|AAT77404.1| putative 60S ribosomal protein L18a [Oryza sativa (japonica cultivar-group)] >gi|113579886|dbj|BAF18249.1| Os05g0565000 [Oryza sativa (japonica cultivar-group)] >gi|125553330|gb|EAY99039.1| hypothetical protein OsI_20997 [Oryza sativa Indica Group] >gi|125595234|gb|EAZ35293.1| hypothetical protein OsJ_018776 [Oryza sativa (japonica cultivar-group)] >gi|215734942|dbj|BAG95664.1| unnamed protein product [Oryza sativa Japonica Group]
Score 400
Evalue 1.20202e-85
Total Hit Count 289
Registered year 2002
Contig Sequence     [ Download ]
>Contig16166
gaCATCTGCATTTGAAagcagaccaaaccacaTAGCAGCTGAGGGCTAGCAGTTGACGCTACCAGGTAGCGAAACATACTGAAGCAACAATGGATCCGCT
GCGCATTACTAATACCAAACAAAGTCAAGAGTTGCATCAAAGCAGCATCATCCTTAGCGACTGAAAACATCATCAAAGTGCTTAACCAAAACTTCCACAT
GCAAAAATCTTCAAACTCTTACACGCTAAAACACAGCACAGACCAGTAGAGTAGGGACCCGA*TCACATGAACAGGTTGGGCCTCGTCGCCTTGTAGGTG
GTCTTGAGCTTGCGGGTGGGTGGGCGCACCTTCT*GGTACACCA*GCGGG*AA*CTTGATCTTGGAGTTGTGGAA*CTGCTTCGTGTTGTCCCTCTTGCA
CAGCTTGAAGTCCACCGTCGCAGTCTTGATGATCTGGATGCAGGGGGCACGCACGCGG*TGCCGCGACGCCATCTCCGTGTACATCTGCTCCACGCCCGC
CGTTCAGGGTCGTGTCGCGGTACTCCTTGTACATGT*TGTGGTAACCGGTCCTGCTCT*GGTAGCGCAGCCAGATGCCCGTAGTTCTTGATGGTGGTGGG
G*TTCTT*CTCAAAGAT*CTCGTTGATGGCGAGCATCTGGCCGTTGGCCTTCTTCACCTT*CTTGAGCTTCCTGAGGAAGTACCAGAACTTGGACTTGGC
GCGGACCTCGTTGGTGGCCCAGAGCTTCATGCGGTAGAT*CTTGGGCTGCTCATCGCCGGGGGTCGGCAGCGCGCGACCCACCACCTGGTACTGGTGGAA
CCTGTGGGCGACCATT*CTGGCGAGCT*C*TCGAGACCGGAGGCGGAGGAGAACTGAAACCTAAGAAGGAgc
page-top