Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16155  (registered. 2002)
Contig Information
Length 1029 bp
Clones 60 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 14
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 12
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 8
Wh_oh Pistil at heading date 6
Wh_r Root 1
Wh_yd Spikelet at late flowering 7
Wh_yf Spikelet at early flowering 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit small Ras-related GTP-binding protein [Triticum aestivum] >gi|19919694|gb|AAM08320.1|AF488730_1 small Ran-related GTP-binding protein [Triticum aestivum]
Score 1053
Evalue 1.1654e-112
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16155
ataaatatatgatccacaCATTGAGCCAACAGGCATAATAATACTGATGAACCATCAAGGTGGCGAACAACAAATCCATGG*CAAGCAACATGATGTAGA
TCAATGTCACACAAACAGTTTGCAGCCCACCAG*ACAAGG*CAAGGCAG*ACAGG*AAAAACATCCGGCTTGACTACTCCATATCAAGCCTTCAACCTAA
AACCGACTCGCATAGTCTCTGGCTCTCAAAGTATTGATTG*ATAAG*ACAGACTCATGATCCTCTCT*CTACTCGATCAGATCGTCATCGTCATCAGGCA
GTGGCTGTGCCGCTGCAGCCGCAAGCTCAGCCTCGTGCTGTTGCTGCATGGCCAAGTCGAAGGTCACTTCC*GGAGGCTTAAGGGCCAC*TGCTTCGACG
AAGTGGATGTTGGGATCACCAGCCAGCTTCCTAGCAAGGTAAAGGAAGGG*C*TTCT*CAAAGTTGTAGTTGCTCTTGGCAGAGATTTCATAGTACTGGA
GGTTCTTCTTCCTGTGGAATGTCACCTGCTTGGCCTTAACCTGCCTGTTCTTCACATCAACCTTGTTGCCACACAGCACAATGGGG*ATGTTCTCACAAA
CCCTGCACAAGTCCCTGTGCC*ACGTAGGAACATT*CTTGTAGGTCAGCCTT*GAAGTGACATCAAACATGATAATCGCACACTGACCATGGATATAGTA
TCCATCCCT*AAGGCCACCAAACTTCTCTTGCCCAGCAGTGTCCCAGCAGTAGAAACGGATCTTTCCACAGTTAGTGGTGAAATCCAACGGGTGAACTTC
AACACCAATGGTGGGTTCGTATTTCTTCTCAAACTCTCCAGTGAGATGCCTCTTCACAAATGTGGTTTTGCCAGTCCCGCCATCGCCGACGATGACGAGC
TTGAAGCTGGGGTAATCGACGGTGTT*CTGGTTCGGCAGCGCCATGGTGGACGCGGGCGGCGACGGCGGCGGtgggggcagggaggcagcaaaaccctag
gtggaggaggagtatttccctcgtgccga
page-top