Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16150  (registered. 2002)
Contig Information
Length 913 bp
Clones 60 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 30
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 9
Wh_yf Spikelet at early flowering 16
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0211800 [Oryza sativa (japonica cultivar-group)] >gi|77549245|gb|ABA92042.1| hypothetical protein LOC_Os11g10590 [Oryza sativa (japonica cultivar-group)] >gi|113644712|dbj|BAF27853.1| Os11g0211800 [Oryza sativa (japonica cultivar-group)] >gi|125576577|gb|EAZ17799.1| hypothetical protein OsJ_032008 [Oryza sativa (japonica cultivar-group)] >gi|215765223|dbj|BAG86920.1| unnamed protein product [Oryza sativa Japonica Group]
Score 351
Evalue 2.40849e-31
Total Hit Count 11
Registered year 2002
Contig Sequence     [ Download ]
>Contig16150
cctagcaaactcaaatcaactaggacccacatgtcatccactagttcgttttccacaagtaaatttgtgaatgaaatcgtgggttcagaaatgaatttga
cacacacagaggttgCAGCGTTTTCTGAGACTCTATTGACATTTTATTTATTGGTGATTACATGACTCAAAGG*AACGACCCTGGG*AGCTCGATCCTTC
TCACATCCCGCCGCGCCATTGTCGCGTCCATCCCCACGACGCAGG*ACGTGAAGAGCTGAGTCC*AGGGCCGGAAGCTAGACTCGGTACTGCGAGCTACC
TATTCTCGCTACCACTACTTGCACGG*CGTCACACAACTCGTGAGCTCATGCACAACACGTACCTGACAGTACACGCTAACAAACTAACAG*ACTCGATA
CTTGAACAG*AGCTTGTTGATCATGAGCAACAAGCTAGGGACCGA*ACGCAG*AACACGATTTATTATGACACAGA*TGCGTGATAAGCTAGTAATAAAA
TGGACACGTACGTGCAGTTCATTCCTCACACCGCGTGCCGTAGCAAACCCCGGCAGGATATAAACAACC*GCAGTTACCGCAGCAATCCATAGGACGAAA
CATGCAAAAACCGCCTGCTGGGAGGCAAGCCAGCTTTGACTCTGCCAAGACGACATCC*ATGAGGCGAGGCATCTGCAACTTTCTTGCCGCCAGCATGCT
GGGCGGCGTGGCCGAAGCCGGCTCCACAGCTGCCATCAGCAGCAGCGCCGCCAGGATCGCCACCACCGCCAT*CTTAGTGGTCGCCATTGCCTCTCCT*C
T*CT*GCCTGTGCCTGTG*CCTGTG*TGTGTTCTgagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagaga
gagagagagagag
page-top