Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16147  (registered. 2002)
Contig Information
Length 1025 bp
Clones 59 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 15
Wh_SL Seed DPA30 7
Wh_dL Crown of seedling 6
Wh_e Seed DPA10 8
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_r Root 6
Wh_yd Spikelet at late flowering 8
Wh_yf Spikelet at early flowering 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L2 [Zea mays] >gi|195636872|gb|ACG37904.1| 60S ribosomal protein L2 [Zea mays]
Score 1318
Evalue 2.19922e-143
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16147
aattcggcacgaggCCACCCATTCCCCTCGCCGCCGCCGCCACTCCGCCGCCGCCGCCGCCGAG*ATGGGTCGCGTGATCCGCGCTCAGCGTAAGGGTGC
GGGCTCCGTCTTCAAGTCCCACACCCACCACCGCAAGGGCCCCGCCCGCTTCAGGTCGCTCGACTTCGGCGAGCGCAACGGGTACCTCAAGGGCGTCGTC
ACCGATGTCATCCACGACCCGGGGCGTGGTGCGCCGCTGGCCAAGGTGACCTTCCGCCACCCGTTCAGGTACAAGCACCA*GAAGGAGCTCTTCGTCGCC
GCCGAGGGTATGTACACCGG*CCAGTTCGTCTACTGCGGACGCCGCGCCACCCTCTCCGTTGGTAACGTCCTCCCGCTCCGCTCCGTGCCTGAGGGAGGC
GTCATCTGCAACGTCGAGCACCACGTCGG*CGACCGTGGTGTCTTCGCCAGGGCCTCCGGTGACTACGCCATCGTCATCAGCCACAACCCT*GACAACGG
CACCTCAAGGATCAAGCTCCCCTCTGGTGCCAAGAAGATTGTCCCAAGCAGCT*GCCGTGCCATGATTGGTCAGGTTGCTGGTGGTGGCAGGACTGAGAA
GCCAATGCTCAAGGCTGGTAACGCCTACCACAAGTACCGCGTGAAGAGGAACTCCTGGCCTAAGGTGCGTGGTGTGGCCATGAACCCTGTGGAGCATCCC
CACGGAGGAGGTAACCACCAGCATATTGGTCACGCTTCCACTGTCCGCCGTGATGCACCACCTGGCCAGAAGGTTGGTCTCATCGCTGCCAGGAGGACTG
GTCGTCTCAGAGGCCAGGCTGCCGCCTCTGCTGCCAAGGCCGACAAGGCCACTTAGAGCTATCGTTGCTGTTTATCTATGTTTGCTGCCTCTAGATTACC
CGTCAAGG*ACATGTATTGCAATATGGA*TGTCGTTTTTGCTCGGTACTTTGGTAACGTGGTGATATTTGTTATCAGTTTTCGCTGTCGTGGT*CTGGAT
TCGTCGGTCCACATAAAGAAGATtg
page-top