Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16144  (registered. 2002)
Contig Information
Length 1536 bp
Clones 59 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 5
Wh_SL Seed DPA30 22
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 1
Wh_r Root 2
Wh_yd Spikelet at late flowering 5
Wh_yf Spikelet at early flowering 15
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit elongation factor 1-gamma [Oryza sativa Japonica Group]
Score 1540
Evalue 7.0428e-169
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16144
ttttttttttACCCAAAAACTCTTAG*CATAGCACAAAATTAACTAGTTCACCAGGTCAAATAGCCATTAAGTAACAAGCAAACTATTCCAAAAAAAGAC
CAACTGTTTCGACACTGAATTTCAAGTCCTAG*ATAGGTTCTTTGCCAC*CGTCACGATCCCAAGCACTGCTCCGCTTACTTGAAGCACTTGGCGTCCAG
CAAGGCCTGCCCCTCGAACGGCTCAAGGTCCTCGATCATGGCTTCCACGCGCTTCTTCTGGGCCTCGTCAGAGAGGTCAACCTTGGTCCACTCGTAGAGC
TCCATGTCATAGACCTCCTTCATGACGAACTCAGGGATGTCCTGCCCACGGAAGAGCCACAGCCCCTTGACCTTGAAGGGCGCCTCAGAACCAATCACGA
GCATCTTGCCAAAAGCATACTTGCGGCACAGATCCATCCGCTGCAGGAACCCGCCGACCTTGTTCAGGGTCACGTACGACACGGTGTTCTCTTCCTGGTA
CTTGTAGTCACAGAACCACAGAGAGTAGCCCTCTGGGTCATACATCTCCCAGAAACCTTT*AACAGCAACATCATGG*AAGTTGCTCTTAGTGTTTGAGT
ATAGCCTCTTCCAGTCATCAAGTACCATCTTGCTTGGTGGCAGTAGATCAAGGGGATTTTTGGGCTTAGGCTTTGGTGCCTCTTCCT*CTGGTGCCTCAA
CTACTGCTGGCTTTGGGGCCGCCTTGGGAGCCTCTTTCTTGGCCTCCTTTTGTTTAGCAGGAGCAGCCTTCTTCTGAACAGGAGGTACAACCTCTGCCTG
CTTGAATTCGCCAATGACCTTCTTGAAGTTAGGCTGGTTAACCATGGTCCAGAAGTACCTCTCAACATGAGGGAACTCAGATGTGAAAGTCTTGGTCAAG
ATCCGAGCAAAACCATGGTAGAGGTTGCATGTCATGACAATATCAGCCAGAGTGACAGAATGCCCAACAAGGAATGTGTTTGATGCCAGGTGTGTGTTCA
ATGCTTCAAGGGCCCTCTTTAATCCAGCAATGCCGAATTCCTCATCCTGGGCATTGAAAGCCCTATAACCAAGCCTTGGGTACAACCACCTTGCGATATT
GGGATCAACCTCTGTGGCAGCAAAGTCCATCCATTGCTCAACACGTGCATATTCAATAAGAGAACCACCCCAAAGCAGGTTGTCACCCTTTGAGCGAGCA
ACATAGCGTGCAATAGCATTGCTCTCAAAAACAGCACCATCAGGAGTCTCAAGAACAGGAACCTTCCCAAGGGGGTTCAT*CTTGATGAATTCAGGGGTT
TTGTTTGATACACCCATCTCGAAGTTCTTGGGGAGCTCAACCTTGACCCCACAGTACTCTGCAGCAATAAGTGCCTTGAAGGCATTCTTGTTGCCGCTGC
CTGAATGCAAAACGAGCGCCATGTCGGCAGGAGCTGCAGGCTTCACCCGATTCCAAAT*CTCAGATAG*AGAGTGCGGATCGAGACGAGATCGCGGCGGA
AACCTCAGCGGGCGagcctcgtgaagaattncctgc
page-top