Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5328  (registered. 2012)
Contig Information
Length 806 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 2
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 1
WH_XA Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115466028|ref|NP_001056613.1|| Os06g0115500 [Oryza sativa (japonica cultivar-group)]
Score 387
Evalue 8.00E-106
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5328
CAGCATATCATGCAAACAAGTAGCAGGTATCAAAGCCATCCGGTGGTCTCTATTTCCAGCCCCAAAACAAAATTTAGAACAAGTTCCCAATGATAACATT
CACTAGCTGCAGAATGAAACAAAATATCTTATCACTTCTTTTCTTCCTTCTCTGCCTCGGCAGCCTTCTTCGTGCGGGCACCGAGCTGGTGCTGGTTCAT
CCTCTCGACACGGAGCTTGCCGTAGGCCTTGAACGCCTTCATCTCCTCAGTGACCTTCATGATCTCAACCGAGCGCTTCTCACCACGAGTAATAGGCAAG
TAGTCACCCTGGACCTGGGTGGCTGTGGCAAGTTCCTCAGGGGTAGAATCACCAGCCTTAACCTTGTGAGCACACCTTGGGAAGATAACCAGCTTGGCCT
TGTAAGTCTTGAGTCGCTGAATGTTTGACTGCATACCCTCAAGTGACCGGTTTTTACGTCGGTGGTCCACAGAAATGCCAATAGTAGGAGCTAGCTTCTT
CGGGATGCCCGCTGACTTCAGCTCCTCAAGGGTAAAGCCTCTCCCAGCCCTTGCCTTCATGTTGTACTTCCGAGTCTGGCATTGCACAATGGGACGAAGA
GGACCAGATGTAGGGCGAGGGAAGATCTTCACAGCCTTCTTTTGACGAGCAATGCGGCGCCTCTGCTTGCGGGCAGGCTGGTTGAACCAGGTCTTGACAT
AGTTCTGCCAATGCTTCTTGAAGTGGCCGTTAGGGATAACATTGTTGTGCTTCACCATTTCGACCCCTTCTTCTTACCTGCACTGCGGCGGAGGGGAGGA
CGAAGA
page-top