Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16134  (registered. 2002)
Contig Information
Length 720 bp
Clones 58 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 10
Wh_SL Seed DPA30 6
Wh_dL Crown of seedling 3
Wh_e Seed DPA10 7
Wh_f Spike at flowering date 7
Wh_h Spike at heading date 6
Wh_r Root 3
Wh_yd Spikelet at late flowering 6
Wh_yf Spikelet at early flowering 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_20483 [Oryza sativa Indica Group]
Score 616
Evalue 2.89455e-62
Total Hit Count 328
Registered year 2002
Contig Sequence     [ Download ]
>Contig16134
attcggcacgaggctCTCTCTCTCCTCGCACCGCGTCCCCTCCCTCTCCTGTCGCGTGCGCTCGGCCAGCAAAAAGC*TT*CCACATAAA*GGCCAACAA
GAGAAACCATAATCTGTTGGGTGCCAGTCAAACCTCAACAACAAA*GTTTCATGTCTGATCTCGACGTTACTCTGCCATCTGCCTTCGATCCTTTTGCTG
AGGCAAATGCTGAGGATGCTGGTGCAGGCCCGGGCGCAAAAGATTATGTGCATGTGCGCATCCAGCAGCGCAACGGCAGGAAGAGTCTGACCACTGTCCA
GGGCCTGAAGAAGGAGTTCAGCTACAACAAGATCCTCAAGGATCTCAAGAAGGAATTCTGCTGCAATGGCACAGTAGTCCAGGATCCAGAGCTAGGCCAG
GTCATTCAGCTTCAGGGTG*ATCAGCGTAAGAATGTTGCTACTTTCCTAGTCCAGGCTGGAATTGCGAAGAAGGAGCTCATCAAGATCCACGGCTT*C*T
AAGCTGAAGCCGCCTCCGATAAATGCCC*GAACCGCCAGCCGGTTCTACTCTATAT*T*GAAGACTTAAGGCATCTATATTGCCGCCCGCTTGTTGAACC
GGTTTCTTGCTTGATGCAAGTTGTGTTGTCACC*TGGTTATTATGCTGCTGCTGTACCAGCATATCAGTATGGTTTGT*CTAAAGATGTTGCCG*A*CTA
AATAAAAATCCGTATCgttt
page-top