Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16126  (registered. 2002)
Contig Information
Length 1083 bp
Clones 57 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 17
Wh_SL Seed DPA30 9
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 8
Wh_h Spike at heading date 7
Wh_oh Pistil at heading date 5
Wh_r Root 2
Wh_yd Spikelet at late flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-beta; Short=EF-1-beta; AltName: Full=Elongation factor 1B-alpha 2; AltName: Full=eEF-1B alpha 2; AltName: Full=Elongation factor 1-beta'; Short=EF-1-beta' >gi|218341|dbj|BAA02436.1| elongation factor 1 beta' [Triticum aestivum]
Score 463
Evalue 5.23972e-73
Total Hit Count 452
Registered year 2002
Contig Sequence     [ Download ]
>Contig16126
gcttcttattgcttggtggtaagatcgagttccgagtccagctcagatatggaaacaactgtaaacaagaacatctggatcatcctatcacagttaTCAA
AGACTGATTTTACTCCACATGATAGATGTTTCGCCATTACAAACCGCTCAGCAATTCAACTATTTAAAGGTAGCAGGCATTCAAG*ACCAGGGCATCACT
CAAAAACAAAACCAGTAGCATTTCTGTAAGAGGGGTAAC*TAAATGGGACGACATAATGTTTTCCAGATCAACCAATCCCAGTACCAAG*AATCCAGCAG
CAACAGGTGGGCGAACAAAGATTCTAGATCTTGTTGAAGGCAACGATGTCACACGACTGGACATACTCGTTGATGGGCGCCTCACAGAGCACTTCCT*CA
ATAAGGGTGTCGACAGACACAAGGTCGTCGATGATCGTCAGCATGATCTGGAGCTTCTTGATGCCATAACCCACAGGCATAAGCTTAGATGCACCCCA*G
GTGAGACCCTCCATTTGAACACTGCGGACAGCCTCCTCCAACTTCTTCATGTCAGTCTCATCGTCCCATGGCTTGA*TGTCCATGAGGACGGAGGATTTG
CCACTTTCTTTCTTCTTT*GCAGGCTTGGCAGCCTCACGCTCAGCTGCTGCTTTCTTGTCCTCCTCGGTCTCATCGCCGAACAGAT*CCATGTCATCGTC
ATCATCTTCATCCTTGGAAGCAGCAGGAGCAGCTGCAGCAGGAGCCGAGGATGCACTCACCCCAGAGGCCTGGCCAGGGAACCTTGAAGAAACGGCCGCG
GCGACGGGCGTCGTACCAGCGGGC*AGCGTTCAGGAACTCGGCGCTGGGCTTCACGGGCACCGCCGCGAACACCTTGACGTCGT*CCTTGGTGATCCCAT
CGCCGGAGATGTAGGTCTTGCCGGCGAGGTGCGCCTCGAGGGCCTTGAGCCCGTCGGCGGTGTGGAGGTCGGAGAACGTGACGGCCATCGGATCCGGCGA
GCTCGGGGGCTTGTCGAATTCGCTGGGCGGCGGCG*GCGGCG*CTGGAGGCTAAAATCCC*Cctcgtgccgaattncctgcag
page-top