Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16124  (registered. 2002)
Contig Information
Length 1243 bp
Clones 57 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 6
Wh_e Seed DPA10 51
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit low molecular weight glutenin subunit [Aegilops uniaristata]
Score 312
Evalue 1.30598e-26
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16124
taATTAATTAAGGCACCAGGTTGCGCTTGTGACAAGGAAAGACAAACTTATGAACTTGCAAGCATGGCAATCAGATTGACATCCACACAATGCCAATATG
AACATTGTCTTGATACAACTTTATTTTTATTTTATTTCAGAATTTAAACAACTAGTTTGGGCGGGTCACACATGACATTGTGTGACACTTTATTTGTCAC
CGCTGCATCGACATATCCATCGACTAAACAACGGTGACCCAATTATATATTACTAGAGATCTTTCCTTATCAGTAGGCACCAACTCCGGTGCCAACGCCG
AATGGCACACTAGTGGTGGTTCTGTACAACGGCACATTAACACTGCACATCGTTGGCAGGATACGGAGCGCAATGGAAGTCATCACCTCAAGCTGAGCTA
TCTGGTGTGGCTGCAAAAAGGTACCCTGTGCCAATTGTTGTTGTTGAGGTTGTTGCCCGAGTTGCTGCTGCGACTGCTGTT*GGGGTTGGGAAACACATT
*GGCCCAAC*TGTTGGGGTTGC*TGC*TGCTGAGATTGGATGGAACCCTGAACCTGTTGTTGTTCTTGCAGGATGATGGAGTAGATGATAGCACGGATTG
CC*TCATAGCGGG*ATTGCTGGGGG*ATTT*GCGGCAACTGCTGGCAACATTGTTGTTGCATCACATGGCAACTGCTCTGCTGCAACATTTGCGACCTAG
CAAGACGTTGTGGCATTGCCACAGGGCTGCACTGCTGCTGGAGGAATACCTTGCATGGGTTTAGCTGCTGCAAAATGGATGGCTGAACAACAGGGATTTG
TTGTTGCACCAGCTGTTGGTGTTGTTGTTGTTGTTGTGGAAAAGGTGATTGTTGTGGAGGTAAAACTGGTTGTTGTTGCTGTGAAAATGGTGGTTGTTGC
GGTAGAACTAGTTGTTGTTGCTGCGAAAATGGTG*GTTGCTGTGGTAGAATTGGTTGTTGCTGAGAAAATGGTGGTTGTTGCTGCCAAAATGGTGGTTGT
TGCTGCGAAAATGATGGTTGTTGAGGAAATAGTTGTTGTTGTTGTTGTTGTGAAAATAGTGGTTGTTGTGGAAATGTC*TGTTGTGGTGGTAATGGTTGC
TGCTGCCATGGTCTCTCCAAACCAGGGATGCATCTAGTCTCCATC*TGCGCAATTGCACTTGTCGCCGCAACGGCGAGGAGGGCAAAGACGAGGAAGGTC
*TT*C*ATGGTGG*ATTGGTGTTAACTAGTgcctcgtgccgaa
page-top