Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16120  (registered. 2002)
Contig Information
Length 881 bp
Clones 56 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_SL Seed DPA30 10
Wh_dL Crown of seedling 9
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 1
Wh_r Root 6
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 14
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L18 [Triticum aestivum]
Score 949
Evalue 1.03555e-100
Total Hit Count 351
Registered year 2002
Contig Sequence     [ Download ]
>Contig16120
caaagaggcaccgaagctaagcaatGACTGGTTGCAACGAAACATGGTCTTCAAG*CTCACAAAATCAAAACAGTTGACAGC*AATAAG*AATCTTGCAA
AATATCATTCGAACACTGGGGCGATAGATTTTGCTACTCTCAGTACAAAGTACTTTACTAATTACTATCAATTGCTCAAACAGAACAACAGCCGCTCCAC
ACAAACAGCGACTAACAAGAAAGGGCGACTTAAACCTTGAAGCCACGGCTGTTCCTCCTACCACGAGCCTTCTCAAACTTCCTACCCTTGGAGCGCACAT
AGGG*CTTGGTGTGGCTGTGCGGCACACCA*GG*CGCCTTGCCGAAGTGCCTCACCGCCTCACGCGCATTCTTGGGTCCCCTCAACAGGA*TCGTGTTCT
CCCCAGTTGGAGCACGGAGAGCAAGCTGGTCAAAAGTGAGGCACTCCCCACCAGCATTGATAATCCTTGCCCTCGCTGTCTCTGTGAACCTCAGAGCAGT
AACCTTCATTGCTGGGACCTCTTGGATCCGCATGTCATCTGTGATTGTACCAACAACCACAGCAATGTTCTTCTCCTCCTTTCCCTTCATGAAGTT*GGA
GAGGCGGCGCATGGAGAGCGGCGGGCGGTTAGTCTTGCTCATGAAGAGCCTCTTGAGGATGACGGCGTTGAACTTGCTCTTGGTCCTCCTCACCAGGAAA
CGGTAGAGCTTGACGAGGAGCTT*GAGGTAGACATCGTCGGACTTGGGCGCGACGCGCTTGGTCCT*CTTGTTCCTCCCGCCGGCGACGAG*GTCGATAC
CCATGGCTGCTT*CTGCGTCGGCGGCGGTAGGGTTT*CCTCGCGGTGTCGCGCTGCGGCTGCTGCTTCTTACCtcgtccgc
page-top