Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16116  (registered. 2002)
Contig Information
Length 1730 bp
Clones 56 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 11
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 3
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 6
Wh_h Spike at heading date 14
Wh_oh Pistil at heading date 5
Wh_yd Spikelet at late flowering 5
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_021523 [Oryza sativa (japonica cultivar-group)]
Score 1028
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16116
ttttttttttcTGAGGAATACGTAAATTCATTTATACATAGACTCTTTCAAGCAACCATCAAGAAGAGATCACATCATCTGCACCCATCGTACATGCCAA
ACAATAAT*CAT*CTACTTGAAGAAGTATGGGAGGTCGAGCACGTAG*AGGAGGAAGTAGGCCCAGATGGCGCCCGAGACACCGCCGAA*GAAGAAGCCT
CCGGTGAACTGCGACCAGCCTTCCGCAGTCTGCAGCTTGTCGGCCTCCTTCTTGCGGCCGGTGAGCGTGAGCGCGGGCGCGGTGGAGGGCGCGCCCTCGT
TGAAGGAGGCGACGCCGTACATGGTGAGGCAGACGCTGAGGATGGAGACGAGGCCGATGGCGCCGAGGGTTCCCGCCTGGCCGTGAATTGGCGTGTTGCG
GAGCGGGCCGGTGAGggtcttcacgaaaatct*gcatACCACCACGG*AGACGGAGCACCAGGTGAAGGGTGGACTCCTTCTGAATGTTGTAGTCTGCAA
GGGTGCGGCCGTCCTCCA*GCTGCTTGCCAGCAAAGATCAGGCGCTGCTGGTCCGGGGGAATGCCCT*CCTTGTCCTGGATCTTGGCCTTGACGTTGTCG
A*TGG*TGTCGGAGCTCTCAACCTCAAGGGTGATGGTCTTGCCGGTGAGGGTCTTCACGAAAATCTGCATACCACCACGG*AGGCGGAGCACC*AGGTGA
A*GGGTGGACTCCTT*CTGAATGTTGTAGTCTGC*A*AGGGTGCGGC*CG*TCCTCCA*G*CTGCTTGCCAGCGAA*GATCAGGCGCTGCTGGT*CCGGG
GGAATGCCCTCCTTGTCTTGGATCTTGG*CCTTGACATTGTCAATGGTGT*C*GGA*GCTCTC*AA*CCTCAA*GGG*TGATGGTCTTGCC*GGTGA**G
GG*TCTT*CACG*AAAA*TCTGCAT*ACC*ACCACGG*A*GGC*G*GAGCACC*A*GGTGAA*GGG*TGGAC*TCCTT*CTGGATGTTGTAGTCGG*CCA
*GGGTGC*CGGCCGTCCT*CCA*GCTGCTT*GCCAG*CAAA*GA*T**CAGG*CGCTGCTGGTCCGGGGGA*A*TGCCCT*CCTT*GTCCTGG*ATC*TT
*GGCCTT*G*ACG*TT*GTCAA*TGGTGT*C*GG*AGCTCT*CGACC*TCCAGG*GTGATGG*TCTTGCCAGTGAGGGTCTTCA*C*GAATATCTGCATG
CCACCACG*CAGACGCAGGACAAGGTGG*AGGGTGGACTCCTTCT*GGATGTT*GTAGTCA*GCGAGGGTAC*GGCCA*TCCTCCAGCTGCTTGCCAGCG
AAGATGAGACGCTGCTGGTCCGGA*GGAATGCCC*T*CCTTGTCCTGGATCTTGGCCTTGACATTGTCGATGGTGTCAGAGCTCTCAACCTCCAGAGTGA
TGGTCTTGCCGGTGAGGGTCTTCACAAAAATCTGCATACCACCACGGAGGCGGAGCACCAGGTGAAGGGTGGACTCTTTCTGGATGTTGTAGTCGGCCAG
GGTGCGGCCGTCCTCCAGCTGCTTGCCAGCAAAGATCAGGCGCTGC*TGGTCCGGGGGAATGCCCTCCTTGTCCTGGATCTTAGCCTTAACATTGTCAAT
GGTGTCAGAGCTCTCAACCTCCAGAGTGATGGTCTTGCCAGTGAGGGTCTTCACGAAGATCTGCATCTTGAGACGATGGGGGAGGAGGATTCGACGAGCT
C*TCGAGTCGATCGGAGACGAGATTGGgtg
page-top