Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16114  (registered. 2002)
Contig Information
Length 754 bp
Clones 55 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 15
Wh_SL Seed DPA30 4
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 7
Wh_h Spike at heading date 9
Wh_oh Pistil at heading date 7
Wh_yd Spikelet at late flowering 9
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gluconolactonase precursor, putative [Aspergillus flavus NRRL3357]
Score 89
Evalue 0.404361
Total Hit Count 3
Registered year 2002
Contig Sequence     [ Download ]
>Contig16114
gaTCGCTCGCGTGTTGGAGATCGAG*AGAAGGAAACCCTAGCCGCCGTCGTCCAG*A*TCTGCTTGGGTTGGTGGAGGGTATGGCTATGGCGCTGCGCAC
CATGGCCGCCAAGCTGAAGCAGAAGATCCCCGCCGCTGTCCAGCGGGTTCGCGTCTCTTCTCGTGCTCCGGCACCTGCTGATGCTGACTTCGACCGCTTC
GGCCCAGAGTTTCGCCGGGCACTGG*ACAAG*ATTGTAGAGAAACACAGGAAGAGGCGCAGGAACGAGGCCTTGGCCTGTGGTGCTGGCTTCAGTCTTGG
AGCACTCACCTTTTTGCTTGGGGTCCATCGGCTTGGTTGAAGGAGATGGCTCA*ATGGTGAATGACT*GGAATATCTATCCTGCACC*G*CATGTTCTAC
TATCTACTACTGCACCCGCAAGTTCTACTTATCTACTAGTGCTATATCCTGCACCGCAAGTTCTACTATCTACTAGTACTATATATATCATGCATGTTTT
AACTAGCC*GGTGTACTCTGTAATT*CC*TG*G*CTTGTGTGTTATGTAAGATCACTACTGTATGTACAATGGGGATCCCAGGTT*CTGTGGGATCTAAT
TTCGGTG*GTTGC*ATGTGGGATGTAAGGGCACT*CTATCGCCACTGCTTAT*C*TGTTGTTATCAGAG*ATCTATATTCAGCCGTGTTGTTAAT*CTGT
TGTGGTGTTCTCACCTTCGAGTAatgaatTGTATGCgttttgctaaaaaaaaaa
page-top