Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16110  (registered. 2002)
Contig Information
Length 1530 bp
Clones 53 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_e Seed DPA10 6
Wh_f Spike at flowering date 13
Wh_h Spike at heading date 15
Wh_oh Pistil at heading date 7
Wh_r Root 8
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0276100 [Oryza sativa (japonica cultivar-group)] >gi|6539562|dbj|BAA88179.1| putative isocitrate dehydrogenase [Oryza sativa Japonica Group] >gi|81686717|dbj|BAE48299.1| NAD-dependent isocitrate dehydrogenase a [Oryza sativa Japonica Group] >gi|113532256|dbj|BAF04639.1| Os01g0276100 [Oryza sativa (japonica cultivar-group)] >gi|125569901|gb|EAZ11416.1| hypothetical protein OsJ_001241 [Oryza sativa (japonica cultivar-group)] >gi|215765348|dbj|BAG87045.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1037
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16110
tttttttttTAGAACAAACAAATTATATG*CGCTGATGCTGCCAATG*ATTATTACAG*ACGATTCTT*CAGCTTGACTGCAATGCTGGT*AAAACTTTT
CCAAGG*ACAAGAATGCGAGGATTATTCAGGAGCCTTAAACGGTGTCTCAACACCCAAGGAAATCGAGGTGCCTGCCAC*TT*A*CCTACTCAGGGCTAA
AGCTCCCGGTATGCAACAAAATTAGGTGGGAGACAAATAATCGAGAGAAAGAGCAGCTGGTGCTCAGATATGATCGCAAACTGCTTTTGTGTAGTCTGAC
GTTGATGACTTCCCACCAAGATCAGCGGTTCTGTACTTCCCCTCGGCAATTGTCTGGAGGATGGCATTGTGGATCCGGTCTG*CTTGGTCATTGAATTGC
AAGTGGC*GCAACATCATAACAGCACTCAACATAAGAGCAGTTGGGTT*TGCAAGGTTCTTGCCAGAGATATCAGGTGCAGAACCATGAACAGCCTCTGC
CAGACAAATGCCACCTTCACC*AATGTTGCAGCTGGGAGTTAAGCCCAAGCCTCCGATCAAACCAGCACATAGATCACTAATAATGTCACCATACAGATT
TGGCATCACTAATACATCAAATGTACCAGGATTCTTCACGAGTGTCATGCAGCAATTGTCAATGATGACTTCCTCATATGTGATTTCAGGG*TACTTCTC
AGCTACTTCACGGCAACACTTGAGG*AAAAGTCCGTCTGTTTTCCTCATGATATTAGCTTTATGTATCGCAGAGACCCTCTCCCTGCCATTGGCTTTGGC
ATAATGGAAAGCATACTCTGCCACTCTCAAACTTGCTTGGCGGGTAATAATTTTCAAACTTTCCACAACACCCCTCACAACCTGATGCTCAAGggcCACT
ATACTCTCCTTCAGTATTTTCACGGATTGTCACAAGGTTCACATCATCATATCTAGTCTTGTAGCCTGGGAGGCTGTTGCAAGGCCTGACATTGGCGTAG
AGTCCGAGTTCTTTCCTTAATGTAAGATTCAAAGAACGGTGGCCTTTTCCAATAGGTGTAGCCATAGGACCTTTCAAGCCAACTTTGTTTCTACGCACCG
ACTCCAGGCTCTCCCATGTCAAAAAGCTCTCTGTTCTGGGATCAACTTCCGTACCAACATAATGTTCTTCCCATTCTATAGGTACACCTGCAACATTGAA
TACCTGCTTGACCGACTCGGCGATCTCAGGCCCGATGCCATCACCGGGAAACAGGGTTGCGCGGATAGTCTCCCCAGCCTCCGTGGAAAACGATGCCCCA
ACATGCCGGCCCGTCGTCCGCGGTAGGACAATCCCCTGAAGCAGCCTTCGGAGTGCCATGTCTCCTCTCCACCACTCGGAAGAAGGAGATTCGCGGGTAG
TGT*CAACGGCGGCGGCGGCGGGCGGCGGATGGGCTCCGCGGTGAGAGGGGGGAGGGGGCGGGGAGCGGTGGACGAAAGATGGGGATGGGAAAGGGAGAA
AAAagggtggcAATTTGCACAGactcttgc
page-top