Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16101  (registered. 2002)
Contig Information
Length 889 bp
Clones 52 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 12
Wh_dL Crown of seedling 11
Wh_e Seed DPA10 8
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 6
Wh_oh Pistil at heading date 7
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100216924 [Zea mays] >gi|194697072|gb|ACF82620.1| unknown [Zea mays] >gi|195621176|gb|ACG32418.1| cytochrome b5 [Zea mays]
Score 653
Evalue 2.17561e-66
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16101
caattccgctccccctccttgg*atccaacccccaaACCCCATCCATCACTCT*CGCCTCGCTTGACTCCTCC*TTGG*AAGCACAG*AG*AGAGAGGAG
AGCATGGCGTCGTCCGGTGGCAAGCTCTTCACCCTGG*AGG*AGGTCGCCAA*GCACAGCT*CC*AAGGACGACTGCTGGCTAGTCATCGGCGGCAAGGT
GTACAATGTGACCAAGTTTCTCGATGACC*ACCCTGG*AGGCGACGACGTCTTGCTGTCTTCAACAGCCAAGG*ATGCGACC*GACGACTTCGAGG*ACG
TGGGGCACAGCACGACC*GCCCGGGCGATGATGGACGAGTACTACGTGGGCGAGATCGACGCGACCACGATACCCACCAAGGTCAAGTACACGCCGCCCA
AGCAGCCGCACTACAACCAGGACAAGACCCCCGAGTTCGTCATCAAGATCCTCCAGTTCTTGGTCCCCCTCGCGATACTGGGCCTGGCCGTCGCCGTACG
GATCTACACCAAGGCGGAGTCTGTCTAGCACC*GTCGTCTTATACCAGTCAGTCAGTCAGTCATTCGGAAGTGTCCAAGAGCTGAATAAGTTTTAGTGGG
GATTTGCATATTTTGTGTACCAGCGTCACCGTCCTGTCATGGAAT*CTGGGAACTGCT*CTCGACCCGTCGTTGCGTTATGGTTCTACT*GACGT*CCGC
TGTTGAAATCGTGACTCGGGAAAAACGGATAGATACTTG*GCTATATTTT*CCATATCGCTGGTGAATGTT*CAGACATACATATTCTTAATTtgatgtg
attagttgtgtatgtgtcactttgtttgtgccccttgttcgacagtctcggttgtcacacgaaggcctgtaggcgcaccaaatttgtac
page-top