Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16079  (registered. 2002)
Contig Information
Length 588 bp
Clones 49 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 30
Wh_dL Crown of seedling 4
Wh_oh Pistil at heading date 3
Wh_r Root 2
Wh_yd Spikelet at late flowering 1
Wh_yf Spikelet at early flowering 9
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0835900 [Oryza sativa (japonica cultivar-group)] >gi|113534260|dbj|BAF06643.1| Os01g0835900 [Oryza sativa (japonica cultivar-group)]
Score 414
Evalue 4.86147e-39
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16079
tttttttttttttttttttcAGTTCGAACGGATGCCAACATCTT*CATTACATAATTTCATGATTCAGTTAACCATACAGAGG*AAATGGGGAAACAAGG
CGGTTTCCATCTGAG*ATTTCTTGAGCGCAACACTACTAGGAACGGGCGGACTAACACATCGGAATCTGCAGGCGGC*GACGAAGACTGACGACCAT*CT
GGCGGGGGCCAGCGGCCTAGCCGCCGAAGCCGTAGAGGGTGCGGCCCTGGCGCTTGAGGGCGTAGACGACGTCCATGGCGGTGACGGTCTTGCGGCGGGC
GTGCTCGGTGTAGGTGACGGCGTCGCGGATGACGTTCTCGAGGAAGATCTTGAGCACGCCGCGGGTCTCCTCGTAGATGAGCCCCGAGATGCGCTTCACG
CCGCCCCTCCGAGCGAGCCTCCGGATGGCCGGCTTGGTGATGCCCTGGATGTTGTCGCGCAGCACCTTCCGGTGGCGCTTGGCGCCGCCCTTGCCGAGCC
CCTTGCCGCCCTTGCCGCGCCCGGACATGGTCGCTGACGATCCT*C*TTGGAGCTGCTGCGCGAGTTGGA*TTGGGGGAGGAGTGGtc
page-top