Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16073  (registered. 2002)
Contig Information
Length 1208 bp
Clones 49 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 49
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Aldose reductase; Short=AR; AltName: Full=Aldehyde reductase >gi|18891|emb|CAA40747.1| aldose reductase-related protein [Hordeum vulgare subsp. vulgare]
Score 1642
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16073
ttcggcacgagggaAAGAAGAACAGACTTGAGAAGGGAGGAGAGGTTTGAGATTCAGAAGGCGTGATCATTCATGGCGAGCGCCAAGG*CGACGATGGGG
CAGGAGAAGCAAGACCACTTCGTTCTCAAG*AGCGGGCATGCCATGCCGGCCGTCGGGTTGGGCACCTGGAGGGCTGGCTCGGATACTGCTCACTCCGTT
CAGACGGCCATCACCGAGGCTGGATACAGGCATGTGGACACAGCTGCTGAATACGGAGTAGAAAAGGAGGTCGGCAAAGGGCTTAGAGCTGCCATGGAAG
CTGGAATCGACAGGAAAGATTTGTTTGTCACGTCAAAATTATGGTGCACGAACTTGGTCCCTGAGAGGGTGCGGCCAGCATTAGAGAGCACGCTCAAGGA
TCTACAGTTGGACTACATCGACCTTTACCATATTCATTGGCCGTTCCGGCTGAAAGATGGGGCACACAAGCCTCCGGAAGCA*GGGGAGGTGCTGGAATT
CGACATGGAGGGGGTGTGGAAGGAGATGGAGAACCTTGTCAAGGACGGACTGGTTAAGGACATCGGCGTCTGCAACTACACCGTGACCAAGCTCGACCGG
CTGCTACGGTCTGCAAAGATTCCACCGGCCGTTTGCCAGATGGAGATGCACCCTGGTTGGAAGAACGACAAGATGTTCGAGGCCTGCAAGAAGCGCGGGA
TCCATGTCACCGCTT*ACTCACCATTGGGTTCTTCAGAGAAGAACCTTGCTCATGACCCGGTTGTCGAAAAGGTGGCCAACAAGCTGAACAAGACCCCGG
GGCAGGTGCTCATCAGGTGGGCTCTGCAGAGGGGGACGAGTGTGATTCCCAAGTCAAGCAAAGACGAGAGGATCAAGGAGAACATCCAGGTGTTCGGGTG
GGAGATCCCTGAGGAGGACTTCAAGGTCCTGTGCAGCATCAAAGATGAGAAGCGTGTGCTGACCGGAGAGGAGCTGTTCGTGAACAAGACCCATGGGCCG
TACAAGAGTGCATCTGAAGTCTGGGATCACGAGAACTGAGCTCCCACCTAAGTCACCAGTCGCCATCTACGACGACTCACAACAATGGAGGCTGAAGGAG
TGGAGTGGAGATGATGCAGCAGGCTCTT*CTTGATGCTATGTAA*ACAACGTT*GTGTACAACACAATAAATAAATAAATAACAACGGCT*TCGTCGTGC
CCcttgtt
page-top