Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16070  (registered. 2002)
Contig Information
Length 1878 bp
Clones 49 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 11
Wh_dL Crown of seedling 3
Wh_e Seed DPA10 17
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 4
Wh_r Root 3
Wh_yd Spikelet at late flowering 1
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=UTP--glucose-1-phosphate uridylyltransferase; AltName: Full=UDP-glucose pyrophosphorylase; Short=UGPase; Short=UDPGP >gi|1212996|emb|CAA62689.1| UDP-glucose pyrophosphorylase [Hordeum vulgare subsp. vulgare]
Score 2148
Evalue 0
Total Hit Count 416
Registered year 2002
Contig Sequence     [ Download ]
>Contig16070
gaggaattcggacGAGGCgccacctCTCCCTTC*AGTCATCTGACATCTGCTCCCGTCCTCTCCTCCT*CTCC*CCCCCG*AAGCAGCGTGCGCGTCGCT
CCTCTCCGCCCGGATCGCGATGGCCGCCGCCGCCGTCGCCGCCGACTCCAAGATCGACAACCTCCGCGACGCCGTCGCCAAGCTCGGCGAGATCAGCGAG
AACGAGAAGTCCGGGTTCATCAGCCTCGTCTCGCGCTACCTCAGCGGCGAGGCGGAGCAGATCGAGTGGAGCAAGATCCAGACCCCCACCGATGAGGTGG
TGGTGCCCTACGACACCCTCGCGCCCCCTCCCGAAGATCTCGACGCCATGAAGGCCCTGCTCGACAAGCTCGTGGTGCTCAAGCTCAACGGAGGCCTCGG
CACCACCATGGGCTGCACCGGCCCCAAGTCTGTCATTGAAGTTCGCAATGGGTTTACATTTCTTGACCTTATTGTGATTCAGATTGAGTCCCTGAACAAG
AAGTATGGATGCAGTGTTCCTTTGCTTCTAATGAACTCTTTCAACACTCATGATGACACACAGAAGATTGTTGAGAAGTACTCCAACTCCAACATTGAAA
TTCACACTTTCAACCAGAGCCAATACCCTCGCATTGTTACTGAAGACTTCTTGCCACTTCCAAGCAAAGGGCAGACAGGGAAGGATGGCTGGTACCCCCC
AGGCCACGGTGATGTGTTCCCCTCTTTGAACAACAGTGGAAAACTCGATACCTTACTGTCACAGGGAAAGGAGTATGTCTTCGTGGCGAACTCAGACAAC
TTGGGTGCTATAGTTGACATCAAGATACTAAACCACCTGATCACTAACCAGAATGAGTACTGCATGGAAGTTACTCCAAAAACATTGGCTGATGTCAAAG
GTGGTACCCTCATCTCATACGAAGGAAGAGTCCAGCTCTTGGAGATTGCCCAAGTCCCTGATGAGCATGTGAATGAATTCAAGTCGATTGAGAAGTTCAA
GATATTTAACACCAATAACCTGTGGGTGAACTTGAA*GGCGATCAAGAGGCTTGTAGATGCTGAAGCACTTAAGATGGAAATCATTCCCAACCCTAA*GG
AAGTTGATGGCGTGAAAGTCCTGCAGCTAGAAACCGCA*GCTGGAGCAGCGATCAGGTTCTTTGAGAAAGCAATCGGCAT*CAACGTTCCCC*GCTCAAG
GTTTCTGCCCGTGAAGGCTACATCTGATTTGTTGCTTGTGCAGTCTGATCTCTATACC*TTGGTTGATGGCTACGTCATCCGCAACCCAG*CC*AGAGTG
AAGCCATCG**AACCCTTCAATTGAGCTTGGTCC*TGAGTTCAAAAAGGTTGCCAACTTCCTTGCCCGTTTCAAGTCGATCCCCAGC*ATCGTTGAGCTC
GACAGCTTGAAGGTCTCTGGTGATGTCTCGTTTGGCTCTGGAGTCGTACTCAAGGGCAACGTGACCATCGCTGCCAAGGCTGGAGTCAAGTTGGAGATCC
CAGACGGAGCTGTGCTCGAGAACAAGGACATCAACGGCCCTGAGGATCTTTGAGCGACGCCCGCCGCCATCGCCAGTCGCATTCCCAGAAACCTTCCGGT
CCTCCTTCGCTGAGTTAACC*GTCCTGTAATTTTCGTGTGCATTCTGCTGGGGTGTTGTCCTGGGATAGCCCCTTTACATAATAATTGTAATCCCCT*CT
GTGATGTTCATCTACACTTGTT*CTT*CCTGGGTGTGCCAGGG*ACGTAAAATTT*CTTTTGGTTATATGATGCCCATAGTTTTCACATg*cctaAATTT
GTTTCTTCTTTCGCCCTGCTGGGCTGTAAGAGTTGCTTTTTgctaaagtattttgtgtctccttggcagttgtgccat
page-top