Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16052  (registered. 2002)
Contig Information
Length 1404 bp
Clones 47 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 6
Wh_e Seed DPA10 41
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit low molecular weight glutenin subunit GF-1 [Triticum aestivum]
Score 474
Evalue 2.52138e-45
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16052
ggccaacaacactagttaacaccaatgcccaATGAAGACCTTCCTCGTCTTTGCCCTCCTCGCTCTTGCGGCGGCAAGTGCCGTTGCGCAAATTTCACAG
CAACAACAACAACCACCATTTTCACAGCAACAACAACCACCATTTTCGCAGCAACAGCAATCACCATTTTCGCAACAACAACAACAACCACCATTTTTGC
AGCA*ACAACAACCACCGTTTTCACAACAGCCACCAATTTCACAGCAGCAACAACCACCATTTTCACAGCAACAACAACCACAATTTTCACAGCAACAGC
AGCCACCATATTCGCAGCAACAACAGCCACCATATTCGCAGCAACAACAACCACCATTTTCGCAGCAACAGCAACCACCATTTTCGCAGCAACAACAACC
ACCATTTTTGCAGCAACAACAACAACCACCATTTACACAG*CAACAACAACCATCGTTTTCACAACAGCCACCAATTTCACAGCAGCAGCAGCAGCAACA
ACAACAACAACAACC*ATTTACACAGCAACAACAACCACCATTTTCACAACAGCCACCAATTT*CACAGCAGCAACAACCACCATTTTCGCAGCAACAAC
AACC*ACCATTTTCACAGCAACAAC*AAATACCAGTTATTCATCCATCTGTTTTGCAGCAGCTAAACCC*ATGCAAGG*TATT*CCTCCAGCAGCAGTGC
ATCCCTGTGGCAATGCAGCGATGTCTTGCT*AGG*TCACAAATG*TTGCAGCAGAGCATTTGCCATGTGATGCAGCAAC*AATGTTGCCAGCAGTTGCGG
*CAAATCCCCGAGCAATCCCGCCATGAGTCAATCCGTGCTATCAT*CTACTCTATCATCCTGCAGCAGCAGCAGCAGCAACAACAACAACAACAACAGGG
TCAGAGTATCATCCAATATCAGCAACAACAACCCCAACAGTTGGGCCAATGTGTCTCCCAACCCCAACAGCAGTTGCAGCAGCAACT*CGGGCAACAACC
TCAACAACAACAATTGGCACATGGTACCTTTTTGCAGCCACACCAGATAGCTCAGCTTGAGGTGATGACTTCCATTGCACTCCGTACCCTGCCAACAATG
TGCAGTGTCAATGTGCC*GTTGTACGAAACCACCACTAGTGTGCCATTAGGCGTTGGCATCGGAGTTGGTGTCTACTGATAAGAAAAGATCTCTAGTAAT
ATATAGTTGGATCACC*GTTGTTTAGTCG*ATGGATATGTCAATGTAGCGGTGACAAATAAAGTGTCACACAACGTCATGTGTGACCCGCTCAAACTAGT
TGTTTAAATT*CTGAAATAAAATACAAATAAAGGTGTATTAAGAAAATGTTCATATCGGCATTGTGTGGATGTCGATCTGATTGCCATGCATGcaaaaaa
aaaa
page-top