Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16043  (registered. 2002)
Contig Information
Length 831 bp
Clones 46 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 7
Wh_SL Seed DPA30 15
Wh_dL Crown of seedling 11
Wh_oh Pistil at heading date 2
Wh_r Root 3
Wh_yd Spikelet at late flowering 6
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100216896 [Zea mays] >gi|194696926|gb|ACF82547.1| unknown [Zea mays]
Score 612
Evalue 1.09099e-61
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16043
ttttttttttgACTAGCAACCCATATGAATTAAGATATCACTCCATTTCAAGGTATCCATAGACTGAAAAGCTAGTTTTTTGCATAAATACCACAAGTTT
CTGAACCAAAAATAGG*ATCCAAGCAACATTCATAGTA*CGACTAACAGCAAA*TGATCCTCAACAG*AGCAAAATTAAAGCTCCTCATGACATTCATAG
AAACAGCAGGACTACCCAGAG*AGGAGTAAGTTTCTTGATTGCCACCAGTAGAGTTGGAAGATAGCCTACAGCCTCCTTCCCCTCCTTCCTCCCTTCCGG
CGGGTGCTGTCAGTGGGAACTGGAGTCACGTCCTCAATGCGCCCAATTTTCATCCCAGAACGAGCAAGAGCCCTGAGAGCAGACTGAGCTCCAGGT*CCA
GGTGTCTTGGT*CTTGTTGCCTCCAGTGGCACGGAGCTTAATGTGCAGTGCGGTAATACCAAGCTCCTTGCAACGTGTAGCAACATCCTGAGATGCAAGC
ATAGCAGCATAGGGTGAAGACTCATCACGATCA*GCCTTGACCTT*CATTCCACCAGTGAT*CCGCACCAGGGTTT*CCCTCCCAGACAAGTCAGTCACA
TGGATGAAAGTGTCATTGAAGGATGCAAAGATGTGAGCAACGCCAAAGACATGCT*CTCCCT*CACGGACAGCCGGT*CCAAGGGTGACATTCT*CCT*C
CTTGGGCT*CCCTGGTCTT*CCT*CTTCGACGACATGGT*CGCGTGGAGCGG*CGGTGG*ACCGGAGACGACGACGGCGAGGAGGA*GGAGTGCGCGCCT
GGTTGAGATCACGATGAGcctcgtgccgaat
page-top