Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16041  (registered. 2002)
Contig Information
Length 848 bp
Clones 46 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 7
Wh_dL Crown of seedling 9
Wh_e Seed DPA10 5
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 7
Wh_oh Pistil at heading date 1
Wh_r Root 7
Wh_yd Spikelet at late flowering 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_13062 [Oryza sativa Indica Group]
Score 367
Evalue 3.02673e-33
Total Hit Count 63
Registered year 2002
Contig Sequence     [ Download ]
>Contig16041
actggtgctgcacttagggcaagcatatttaaagggtacagcagggacatcaagctctcaaaagtactcaaaaaatgaagttgcaacgcaccatATTTAA
ACTCCATATTTATAAACCCACTGCCATGAAGGTAATTCCAACAT*CAA*TACAAGG*AAATACTCCCAGGACAACAGAGACCACAAACTAGGGTAGGTAA
TAGACATAAGCTGTGGCATAGGTTCATAATATTGCCAATGAATTATTTAGGAGATATATATCATCATCATCATGACTGAAAACAGGTTCCGACCAATTAA
GCCGCAATCAAGCAAAGATAGTAGCTTAAAGAGTTGCACCAGCTCCTGCTCCTCCACGGCGG*CACTCGTTCAGCATGTCGAGGTAGAACTGGCACTTGC
TGATGTCGCTTCCGTAGTGGTTGATGCAATCTTGGAAGGCCTTGGAAGGGTTGCCACACTTGTCATCAGCAGCATTGTCCATTGGAGTCATAGATGCAGC
AGCCTCACCGACAACAGTCTCATGCTGAATGGTGCGGGGACCCATCACAGCATCAACAGCCCTGTGCGCCATGGCACTGCCAGTACCGAAAGCCATGCCC
TGAGCAATGGTGGACCCAATTCCACTCATGATACC*ACCACCGCTATTCTGGGTAGTAGCAGGTGGAGGAGCTTGACGGGCTGGC*GCTGGTGGGTTT*C
TCACTGGAGCAGCACGTGGAGCAGGGCGGGAAGACCTTCCTCCTCCGCTGCGGCGAGCCATGGCGGCGGACGGCGGGAGGAAACCCTAGGCTGGAGGCGG
CGCCGGGAGGGGAGAATGTATGAACAGGAAGCCAACcctcgtgccgaa
page-top