Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16023  (registered. 2002)
Contig Information
Length 652 bp
Clones 44 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_e Seed DPA10 40
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Alpha-amylase/trypsin inhibitor CM2; AltName: Full=Chloroform/methanol-soluble protein CM2; Flags: Precursor >gi|100833|pir||S13376 CM2 protein - durum wheat >gi|21920|emb|CAA39099.1| CM2 protein [Triticum turgidum subsp. durum]
Score 709
Evalue 3.92695e-73
Total Hit Count 312
Registered year 2002
Contig Sequence     [ Download ]
>Contig16023
ttttttttttatgaacaAAAGATTGAGTTGAAATTTAAGAATCACAAAATGATTCCCTTTATTCTTGTTCATATATATATGCATGCCACACAT*CCATGG
*ATGGAACATGCTTATTCATTCATGAGAGACGGATCTATCCATCTTTATATGTCCAAACCGAGGCAGTATGGGGTGTTGTGAACGGTCATCACGTTGCAG
TGCCC*CGGCGTAACGAGCACCTTGGCGAAGTCCCTCTGGGGCTCCCTGGGGCATCCGGGAAGGTCCTTGAGCACGCCGGAATTGGGATCAGACGTCCGC
CCTATGAAGTAGCGCACCGCCTCGCACCGGCAATGCTGCGAGGCGTCGTAAAGCTCCTTGCAGCACCGATCCCTCGGGGTGTTCCCCGGCTCGGTGGATA
CCGGCGACCCGACGATGCC*GACGCCACAAGTTTGCTGTGCGACATACTCCCGGCAGCCTTCAAGCGGGTTGCTCGGAAGACCCATCCCCGGGTAGCAAT
ACGGGCCTGTGGCTGCGGCGGCGGCGAAGACGGAGACCAGGACGGCGGCCAAGAGGAGGTGGGTGATGCTAGACTTGGACGCCATATTATTCTTT*CTAG
CTTGGT*CCGGTTTGTTGGTGTAGTTT*CTTGAGGTTGTGCACTGTgcctcg
page-top