Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16016  (registered. 2002)
Contig Information
Length 1398 bp
Clones 43 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_SL Seed DPA30 9
Wh_dL Crown of seedling 8
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 4
Wh_r Root 4
Wh_yd Spikelet at late flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_37384 [Oryza sativa Indica Group]
Score 1236
Evalue 1.10672e-133
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16016
aggaattcggcacgagggccgcAAGCCGTCCGCCTCGCTCTTCTCCCGAG*CCTGGTCCTCAtgcCTCTCGCCTCTCTCCCCCCACACAG*ATTTAGCAA
TCTAGGTTTAGCGCCTCCGTCCATCTCGTAGCTGCTGCGATGGCGATCAAGAGGACCAAGGCCGAGAAGAAGATCGCGTACGACCAG*AAGCTCTGCCAG
CTGCTCGAGGAGTACACCAAGGTGCTCATCGCCGTCGCCGACAATGTCGGCTCCAAGCAGCTCCAGGAGATCCGCAAGGGTCTCCGCGGTGACTCCATCG
TGCTCATGGGCAAGAACACCCTCATCCGCCGCTGCATCAAGGTGCACTCGGAGAAGACCGGCAACAAGG*ACTTCCTTGAGCTCAGCAACCTCCTCGTCG
GTAACGTTGGCCTCATCTTCACCAAGGGTGACCTCAAGG*AGGTTCGCGAGGAGGTCGCCAAGTACAAGGTTGGTGCTCCTGCTCGTGTTGGGCTAGTTG
CACCTGTTGATGTGGTGGTTCCCCCTGGCAACACTGGTCTGGATCCCTCCCAG*ACGTCCTTCTTCCAGGTGCTCAACATT*CCC*ACCAAGATTAACAA
GGGCACTGTGGAAATTACTATCCCTGTGGAGCTGATAAAGAAGGGTGACAAGGTGGGCT*CCTCTGAGTCTGCCCTGCTTGCCAAGCTTGGTATCCGCCC
CTTCTCTTATGGGCTGGTCATCTGCAATGTCTATGACAGCGGGTCAGTCTTCAGCCCTGAGGTTCTTGACCTCACCGAGGAAGACCTGATGGACAAGTTT
GCTTCTGGTGTGTCCATGGTTGCCTCACTGTCCCTGGCGATCTCATACCCCACCATGGCTGCTGCGCCACACATGTTCCTCAATGCATACAAGAATGTTC
TTGCGGTTGCTTTGGAGACAGACTACTCATATGATCATGCTGATAAGATCAAGGAGTACCTCAAGGACCCAAGCAAGTTTGCCGTTGCTGCCCCTGCTGC
TGCTGCCTCCGGTGGTGCTGCCGCCGCTGCCCCGAAGGAGGAGGAGAAGAAGGACGAGCCCGAGGAGGAATCAGATGGCGAGATGGGATTCAGCCTGTTC
GACGACTAAGCTGTGTGCCTTCCTTCATAAAGCCGTGTCCAGTCGCCAGTTTTGTTAAGTGTTGAACACTGAAGTTTTTCAAGT*CTTATTATTACCTTG
AACAAGAATTAATTATGCTGTTTGTTAGTGTGTATTCGAATATGTTAACGTTATGTTatgcacttagttacttatgcattgctctgctttgtgcttctct
cttttatgtttgctgggattcacttcgttagattttaagtaggcttgttcatcgattgcnctgttcagacaggctcattcanccagcaaaagtaatgg
page-top