Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16015  (registered. 2002)
Contig Information
Length 1902 bp
Clones 43 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_dL Crown of seedling 11
Wh_h Spike at heading date 10
Wh_oh Pistil at heading date 3
Wh_yd Spikelet at late flowering 8
Wh_yf Spikelet at early flowering 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Tubulin alpha-3 chain >gi|4165488|emb|CAA10663.1| alpha-tubulin 3 [Hordeum vulgare subsp. vulgare] >gi|90289602|gb|ABD92933.1| alpha tubulin-3B [Triticum aestivum] >gi|90289604|gb|ABD92934.1| alpha tubulin-3A [Triticum aestivum] >gi|90289606|gb|ABD92935.1| alpha tubulin-3D [Triticum aestivum]
Score 2163
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig16015
gcagggactacagacggctatgcaggcgtagcaCTTGACTGGAAGCTACAACAGTTACAGGCGTAGCACAGACGCATTTCAAGGACACCACTGATCGCTA
TGACCCTTGCAGCATAGATCAGGGAGGCACAACGAAGAAACAATATAAAGGAGGGGATCATCCAGGCGACGACACCAACCAAATCACCCCAAGGAACAAT
ACAAATACTGAAACAGGGAAATGGTGTAGGCAAACCAGATAACATGCATATTGACCAAGGTGCGAAGCAGGTTCAAACATACCACAGGTTGTAAACCAAA
CACCACACAGCAAACATTCAAACAG*ACAG*ACAGCAG*ATAA*AGCCACTCGGGCAGATCACACG*AA*GG*AACGCTTGGCGTACATCAGGTCGTTGA
ACTCAGCAGCTCTAGTACTCATCACCCTCATCACCATCCTCACCCTCGTCGAACTCAGCGCCAACTTCTTCATAGTCCTTCTCCAGGGCAGCGAGATCCT
CACGGGCCTCAGAGAACTCTCCCTCCTCCATGCCCTCACCCACGTACCAGTGGACAAAGGCACGCTTGGCGTACATGAGGTCGAACTTGTGGTCAATGCG
GGAGAAGACCTCGACAACGCTGGTGGAGTTGGAGATCATGCAGACAGCCCTCTGGACCTTGGCAAGGTCACCGCCTGGGACGACGCTGGGTGGCTGGTAG
TTGATACCACACTTGAAACCAGTGGGGCACCAGTCCACAAACTGGATGGTGCGCTTCGTCTTGATGGTGGCCACAGCGGCGTTGACAT*CCTTGGGCACA
ACATCACCACGGTACATGAGACAGCAGGCCATGTACTT*GCCGTGGCGGGGGTCACACTTGGCCATCATGGAGGATGGCTCGAAGGCGCTGTTGGTGATC
TCAGCGACAGAGAGCTGCTCATGGTAAGCCTTCTCAGCTGAGATGACTGGGG*CGTAGGAGGAAAGCATGAAGTGGAT*CCTTGGGTAGGGCACCAGGTT
GGTCTGGAATTCGTTCACATCAACATTCAGAGCACCATCAAACCTCAGGGAAGCAGTCAGGGATGAGATGACCTGAGAAACGAGCCTGTTGAGGTTGGTG
TATGTTGGGCGCTCAATGTCAAGGGAGCGGCGGCAGATGTCATAGATGGCCTCATTGTCAAGAAGGACAGCCACATCAGTGTGCTCAAGGAGAGAGTGGG
TGGACAGGACACTGTTGTATGGCTCAACAACAGAGGTGGAGACCTGAGGAGATGGGTACACTGTGAACCCAAGCTTGGACTTCTTTCCATAGTCAACAGA
GAGACGCTCAAGGAGGAGAGAACCAAGGCCAGAGCCAGTTCCACCTCCAACAGCGTTGAAGACAAGGAATCCCTGGAGACCAGTGCAGTTGTCTGCAAGC
TTCCTGATACGGTCAAGGCATAGGTCAACAATCTCCTTGCCAATGGTGTAGTGACCACGGGCAAAGTTGTTGGCTGCATCCTCCTTGCCACTGATAAGCT
GCTCAGGGTGGAAGAGCTGGCGATAGGTGCCAGTCCTCACCTCATCAATCACAGTGGGCTCAAGATCAACAAAGACAGCACGGGGAACATGCTTCCCAGC
ACCAGTCTCACTGAAGAAGGTGTTGAAAGCATCATCACCTCCCCCAACGGTCTTGTCACCAGGCATCTGTCCATCAGGCTGAATGCCATGCTCGAGGCAG
TAGAGCTCCCAGCACGCGTTCCCGACCTGGATGCCGGCCTGGCCGATGTGGATCGAGATGCACTCCCTCATGGCTGCGGGTCGGAGCGGCGGAGGCGCGC
GCTGCGCTACGCTGGTGGGGAGATTGCGGGGAGGAGGGGAGGGAGGCCAAAGCTCGGAAGCGCGAGAGAGAGGCGAGTACGAAGACGCCGGCCTCGTGCC
ga
page-top