Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig16009  (registered. 2002)
Contig Information
Length 686 bp
Clones 42 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 42
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Late embryogenesis abundant protein B19.1A; Short=B19.1 >gi|19013|emb|CAA44622.1| LEA B19.1 [Hordeum vulgare subsp. vulgare]
Score 386
Evalue 1.25567e-35
Total Hit Count 91
Registered year 2002
Contig Sequence     [ Download ]
>Contig16009
gaCGAACACCACCTTACGAGCAGTCACACAACGTTTCCCAGTTGAGGTTGTAGTAGCAACGCAGAGAGAGCAATGGCTTCCGGCCAGCAGGAGAGGTCGC
AGCTGGACCGCAAGGCCCGCGAGGGTGAGACCGTCGTCCCCGGCGGCACCGGCGGCAAGTCCCTCGAGG*CGCAGCAGAACCTCGCCGAAGGGCGCAGCC
GTGGCGGGCAGACTCGCAGGGAGCAGATGGGGGAGGAGGGGTACAGCGAGATGGGGCGCAAGGGCGGGCTGAGCACCAACGACGAGTCCGGCGGCGAG*C
GCGCCGCCAGGG*AGGGCATCGACATCGACGAGTCCAAGTTTAAGACCAAGTCCTAGATGATCCGCTAGCTTAGCAAGCAAGACGACTCTGCTTAGGTCG
GCTGTTGGTTTGCCCTAGCGTCCACGTACCGAATAATGTA*GTTCAGGCGCACGTAGGCGATCGTACGTTGTATGATCA*TGTGCGCTTTGTAGCTGGTA
GTTGCTTCGTAGCTGGTAGTCTGTAGGTACTCTACGGTGACGTCGGTCAGTAGCGTCAGGTTAAGTCGGAAGCGTGCTGTGGCTTGGT*CAGGTGGCTGG
T*CTGCCTCTGGGCCCAGGAGTGTCGCAGTGTCCAC*TGTATCCTTGCTTCTTCAGTAATGTATGTCGTCTTGCTcaaaaaaaaaa
page-top