Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15991  (registered. 2002)
Contig Information
Length 750 bp
Clones 41 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 8
Wh_e Seed DPA10 5
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 10
Wh_yf Spikelet at early flowering 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L17-1 [Poa secunda]
Score 418
Evalue 4.41888e-80
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15991
gaTGAAAAATATtccaaacACAACAATATTGAATCCAGTACATGAG*ACGATCATGGGTTTCACAAAGTATGAGCTAGCAGTATTTAGACGACACAGATA
ACAGGCCAAAAATTTCCACTCAGCCAAACCAGATGCTACAAACTGCTCTAACGAATAGGCGGATAGGTTATGTAGAGCTTCCTTCTCTAGGCCTTCCTGG
CGATCTGGGACTCAGCCTCCTTCTTCACCGGCTCTTCCTTCTCCGACAAGATCAGCTCAATGTGGCATGGGTTGGACATGTAGGGGTTGATGCGTCCATG
GGCACGGTAGGTCCGGCGCCGCTGCTTCTGGGCCTGGTTCACTTGGATGTGTGAAATGTAGAGAGCATCAACATCAAGACCTTTCACCTCAGCATTGCTC
TCAGCGTTCTTTAGAAGATCCAGAACGAACTTAGCAGACTTGGCAGGCCCAGCGTCCCTGACCATTGGGCTGACGGTTCTTCACCTGGGCTGTGCGTCCA
ACACCACGGCAGTACCTCCGGAAGGGGATGGCTTGCTT*GTGTGCCAACACATCCTCAAGGTACCTC*TTGGCC*TTGTTGAGCGACATCTTCCTCAGGG
CAAGCGCTGTTTCCCT*AGTGTTCTTGAAATGAACACGCAGGT*CCCGGCCCATGGCCTTGGCGGACTTGGTGGGATTGGCGGGATCCGGTCGAGTACTT
CACCATGGCTGCGGCGGCGCGGGAGAGAAGGCAgcggccctcgtgccgaa
page-top