Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15981  (registered. 2002)
Contig Information
Length 448 bp
Clones 41 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_SL Seed DPA30 7
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 4
Wh_oh Pistil at heading date 4
Wh_yd Spikelet at late flowering 17
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit similar to Dictyostelium discoideum (Slime mold). Phosphatidylinositol 3-kinase 3 (EC 2.7.1.137) (PI3-kinase) (PtdIns-3-kinase) (PI3K) (Fragment)
Score 75
Evalue 5.94535
Total Hit Count 3
Registered year 2002
Contig Sequence     [ Download ]
>Contig15981
ccccgggctgaggaattcggacgagggtTCGTCCACACACT*CCCGCCGCCACCACCGCCGCGAACCGG*AGAGCGAGGCCGACACCGCCGCCGCGATGA
GGGCCAAGTGGAAGAAGAAGAGGATGAGGAGGCTCAAGAGGAAGCGCCGAAAGATGAGGCAGCGATCCAAGTAGGCCGTAAGCATCATCTTGCATCCAGG
CAGCGGAACTCTGAGGGGTGATGGCATTGT*CTAGTGATTCTTGATTTGTTC*TGTTGTTTTGGCTGTGGAAGTTGCTTT*TACCTGTGTTTGGTCAA*A
TTTAGTTGTTTAATACTAGT*CTGGCTATGTTCCAGTACTG*AGTTTTATGTAATGTGAGGATTATATGTGTTTGTGACTGAATTTTATGCACCTATTAT
CCTTGAGGTACTCTGAAATGTGCCTTTTGGCCCTGcacaaaaaaaaaa
page-top