Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15976  (registered. 2002)
Contig Information
Length 1304 bp
Clones 41 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 9
Wh_SL Seed DPA30 6
Wh_dL Crown of seedling 3
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 9
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Populus trichocarpa]
Score 665
Evalue 5.53035e-105
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15976
acgTATAAG*CACTGCAAAATTAAGACGGACAAGTTGAAAGCCAACTTATAACACAAACTTTCAGT*CTCCCTCTCCCTCAT*CACGATGTCGATAGCAG
AGATCACAAATTCATC*TAG*AAAATCCTAAAACACAGGTTTTTGTCCATAGGGTAgcaTATAGCAGATCGCATCAgcaTGCTAGATATCCATTAATGCC
TCACAAAATATGAACTTTAAGCCACAAAgcaCATCTCAAGGGAGCATCCTAGTCTACTCCCAGCCTTGAGCAGGGGGTTGCACCGCGggcGTCCCAGCCA
GTAGCAGCCACAACAGGAGCAGGAACGGCACCTTCCACAGCAACAGGTGCCCCTGCTGCATCCCATCCATCGCCACCAGCAACTGGAGCTTCAGCCATCG
GCCACTCGCCACCAGTAACAGGCGGGGGAGCAGGTGCATCA*GAGGTCCACT*GGTCACCACCCC*ATTGACCAGCTGCAGCTCCGTAATCAGTGATGGC
AGCATACTCTGGGGCTCCAGCAGCTTCATCCTCCTGCTCCTTGGCTTCCTCAGGGTCCCTGTAGAAGAACAGATCAACCATGACATCCCACTTGTGCCCA
GGCAGGATAGTACCCCT*CATCTGCAGAACCATCCTGGCCAAGAGCCAGTACAGGCAGCCAATGCTGTTCCTCCCCTT*GTTGTTTGCTGGGATGCCGAT
AT*CAACGTATCGCATGGG*AGAGTCAGTGTCACAGAAGGCAATGGTAGGGGATGTTCCCCAGAGCAGACTCCTTGATGGGCTGGTGG*TCAGTCCTTGG
GTCGGTGAGGATGAGCAGGCGGGGCTCGCTGAAGGAGGTCTGCATCTGGTTGGTGAAGGTTCCAGGGGTGTGCCTCCCGGCGATGGCGTTGGCGCCTGTG
TGCTGCGCGAACTTGAGGACGGCGCGTTGGCCGTAGGGGCGGGCGGACTGGACGATGATGTCCTGGGGGTTCTCGATGGCGACGATAACCCTCGCCGCGA
GCTGGAGCTTCTCCCATGTCTTGCCCAGATTGATGATGTAGATGCCGTCGGAGCGGCGCTTGTAGGCGTAGCGCTCCATCTGGAAGTCGCAGTTCTTGGT
GCCGAGGTGGACGTCGGCGGCGAGCATCATCTGTATGTCCTGCTCCTTCTGGGACAGCGCCCGCGGGGCCTCTCCAGCCGCTGCCGCCATGGTTGGTCGG
GGACTCGAGCGTCCGGGGGGCGCCGCGAAGGGGAGGAGGAGGAGGGAGGGATGTGAGCGGCGGCGCGAGCGGGGAGAAGCCTCgtgccgaattcctcagc
ccgg
page-top