Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15975  (registered. 2002)
Contig Information
Length 905 bp
Clones 40 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 8
Wh_dL Crown of seedling 7
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 5
Wh_r Root 10
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_12360 [Oryza sativa Indica Group]
Score 675
Evalue 6.48333e-69
Total Hit Count 397
Registered year 2002
Contig Sequence     [ Download ]
>Contig15975
tgagtaaactaggttcaaaagcataATATAAATGTTTTAACAAACTCTGCATAAGCATCTCTGAAACATCCAACAGAACAAACACGATATGATATTTAAG
GTATCTGACACGCTGACACAAACAAG*ATATTGCACAG*AAAACAGTTCTGAACTTCTGATGTTCCAAAATTAGGCTAACCCTTAATAGTACCA*GAAAG
CTAAAGCTTCATGTCAGACCTTCACTTCTTGGCCTTCTTTGGTGCCGCTGCTGCCTGAGCGGGAGCTGCAGCCGCTGGTGCTGGTGCATGATCTCTCGGG
CCCTGAGCCAATCTCTCCTCCCTCCTGGCAATCTTCCTCTCCCTGCTTGCCTTGCT*CTTGGCGCGCTTGGCCTCGAACTGGTCAGAGAGGGTCTTCTCT
CTTGCCTTCTCAGCCTTGGACTTGTGGATACTCTCCATGAGGACCCTCTTGTTCTTGAACATGTTACCCTTGACCTTCAGGTACATGTCATGGTACATGT
GCTTGTCGATCTTCTTGGCCTCACGGTACTTGCGCAGAAGGCGCCTGAGGACGCGCATCCTCCGCATCCACAGGATCTTGGTGGGGAGCCTAGCCTCCCT
GGTACCCC*TACGCTTACCATATCCAGAGTGACGGCCCTTCTGCTTGGCCTCATGTGCCCTCCTTGCACGAGACCTGGAGTGGATCTTCTGAGGCTTCCT
GATGATGAAACCATCCTTCACCAGCTTCCGGATGTTCTGCCGGGAGTTGGCCATGGAGATCTCGTTGACCTCATTGGGGTCGAGCCAGACCTTGCCCTTG
CCGCACTTGAGGACGCTCGAGGCCAGGCGCTT*CTGCAGCTTCAGCGACACCAT*CTTCGCCGCCGCtgcTCCTCCTCCCgtccctcgtgccgaattncc
tgcag
page-top