Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5309  (registered. 2012)
Contig Information
Length 1233 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_SHC Shoot grown with cold treatment 3
Wh_VSCB Liquid cultured tissue 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|110289207|gb|AAP54159.2|| Chaperonin CPN60-1, mitochondrial precursor, putative, expressed"
Score 682
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5309
CCGCCTCTCCCTTCCCCATTCCCTTTCCTCCTCCCCAAGAAACAACCGGAGCTCGCACATCATCTCACCTCGGCGCCTCGCCCCCCTAGCCTCTACGCAC
CTCGACTCCGGCGCCATCTCGCTGCATTCGCCATGTACCGCGCCGCCGCCAGCCTCGCCTCCAAGGCTCGGCAAGCCGGGAGCAGCGCTCGCCAGGTTGG
AAGCAGGCTTGCCTGGAGCAGGAACTATGCCGCCAAAGACATCAGGTTTGGTGTCGAGGCCCGTGCCTCCATGTTGAGGGGTGTCGAGGAGTTGGCAGAT
GCGGTGAAAGTGACCATGGGTCCTAAGGGGCGCACTGTGATCATTGAGCAGAGCTTTGGTGCCCCAAAAGTCACAAAGGATGGTGTGACTGTTGCCAAGA
GCATTGAATTTAAAGATAGAGTCAAGAACGTTGGTGCAAGCCTTGTAAAACAGGTTGCTAATGCAACAAATGATACTGCTGGAGATGGTACCACATGTGC
CACTGTTTTGACAAAAGCTATATTTACTGAGGGCTGCAAGTCTGTAGCCGCTGGAATGAATGCAATGGATCTAAGGCGTGGAATCTCAATGGCGGTTGAT
GATGTTGTGACAAACCTAAAGGGCATGGCTAGAATGATCAGCACTTCAGAGGAAATAGCACAGGTGGGTACAATATCAGCAAATGGCGAAAGGGAAATCG
GTGAGCTGATTGCTAAGGCTATGGAGAAGGTTGGGAAAGAAGGTGTAATCACCATTGTGGATGGTAACACCCTTTATAATGAGCTTGAAGTTGTGGAAGG
CATGAAGCTCGACAGGGGTTACATCTCTCCCTACTTTATTACCAACCAAAAGACCCAGAAATGTGAATTGGAAGACCCCTTGATCTTGATCCATGACAAG
AAGGTTTCGAACATGCATGCAGTAGTTAAAGTGTTAGAGATGGCTCTGAAGAAGCAAAAGCCTCTACTGATTGTTGCTGAAGATCTAGAAAGTGAGGCAT
TGGGCACTCTGATTATCAACAAGCTCCGTGCAGGCATTAAGGTCTGTGCTGTTAAAGCTCCTGGTTTTGGGGAGAACAGGAAAGCAAATTTACAGGACCT
TGCTATCCTTACTGGCGGAGAAGTCATAACTGAAGAGCTTGGGATGAACCTTGAGAACTTTGACCCGGAGATGTTAGGTACATGCAAAANNNNGACTGTT
TCTAAGGATGACACTGTTATTCTTGATGGAGCT
page-top