Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15951  (registered. 2002)
Contig Information
Length 990 bp
Clones 39 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 5
Wh_SL Seed DPA30 5
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 7
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 8
Wh_r Root 4
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0460200 [Oryza sativa (japonica cultivar-group)] >gi|47900319|gb|AAT39166.1| putative ubiquitin-conjugating enzyme E2 [Oryza sativa (japonica cultivar-group)] >gi|113579306|dbj|BAF17669.1| Os05g0460200 [Oryza sativa (japonica cultivar-group)] >gi|125552611|gb|EAY98320.1| hypothetical protein OsI_20228 [Oryza sativa Indica Group] >gi|125594512|gb|EAZ34571.1| hypothetical protein OsJ_018054 [Oryza sativa (japonica cultivar-group)] >gi|215704345|dbj|BAG93779.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767219|dbj|BAG99447.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767276|dbj|BAG99504.1| unnamed protein product [Oryza sativa Japonica Group]
Score 698
Evalue 1.02074e-75
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15951
ctgTCGCGGGCAGATTCTTGGGGAAGGATCCTTCAACGAACAGCCAATTTCTTTGTTTCACGGCGATGACTATGATTAAGTGGCATCACACGAAAATACT
T*CTTGACATTGAC*CAACTCCATGCCACAATACAAT*CGAG*A*GTTCATAATAGGCAGCACCCCAAGTGTCTCGGAGAGACAAGACCAACATCACCAT
TCGACCGACGCTGAATGGAAAATAAACAGGGGAGAAGTGCAAGTGCTGGCATCAGGTGCCCCATTTGGTGAAAGCAAGAGAATTGCAGCGCTTGTGGACT
CCCCCATATGATCCTCCTTTTTCAGAGCATTTCCTGAGATTTGCGAACAAGGCTCCTCACCTTTTTCTTGAACTCGG*CCCTCTTTTCTCTCCAGTCCTT
AGCCGCTTCAATATTTGCTGGAGACTCATCGTTTGGACTAGAGAGCATCGAAATAATGCTCAAAACTATACTCTCAACTGTGTGCACAGGTGTCCACCGT
TCACTTGCAAGCTCGTAACCATT*GGGATCATCACCAGGTGGATGAAGAATAGAAATGCACACAC*GCCCATCAGGATAGACGTTTGGATGCCACATCTC
AGAAGTAAACC*TTACTGATGGAGGACTGTTGGGATAATCCTGAGGAAAGGTCATTACTGCATTGAAGTAGCCTCCATCATATAATGTTTCGGGCGGGCC
GATGATGGTGACCTGCCACTCAAACACGTTGCC*GTCGTCCACCAGCCCCGCCGAGAACCCGTCCACGGGggtTCTTCGCTAGATCTCGGAGCTGCTTCT
GGAGCAGGAGGCTCGCCTGGCTCGGGGGgcgCCGCCATGGGAGGGGAAGCAGAGCTCGATCGGATCGGATCGGCGCTAGGGTTTTTGGCGATTGGGCCTG
GCTTCGCCGCCCTCGGCCTTTATTCGTGGACGCGTGCGTGCGCGTTTGGAGGTGGAGGGTGGGAATCCGCCTCGTGCCGAattgcctgca
page-top