Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15929  (registered. 2002)
Contig Information
Length 1014 bp
Clones 37 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_SL Seed DPA30 7
Wh_dL Crown of seedling 8
Wh_r Root 9
Wh_yf Spikelet at early flowering 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0326400 [Oryza sativa (japonica cultivar-group)] >gi|115480049|ref|NP_001063618.1| Os09g0507800 [Oryza sativa (japonica cultivar-group)] >gi|548774|sp|P35685|RL7A_ORYSJ 60S ribosomal protein L7a >gi|303855|dbj|BAA02156.1| ribosomal protein L7A [Oryza sativa Japonica Group] >gi|38423963|dbj|BAD01672.1| 60S ribosomal protein L7A [Oryza sativa Japonica Group] >gi|38637005|dbj|BAD03264.1| 60S ribosomal protein L7A [Oryza sativa Japonica Group] >gi|113623519|dbj|BAF23464.1| Os08g0326400 [Oryza sativa (japonica cultivar-group)] >gi|113631851|dbj|BAF25532.1| Os09g0507800 [Oryza sativa (japonica cultivar-group)] >gi|125564310|gb|EAZ09690.1| hypothetical protein OsI_31973 [Oryza sativa Indica Group] >gi|125606274|gb|EAZ45310.1| hypothetical protein OsJ_028793 [Oryza sativa (japonica cultivar-group)] >gi|215692651|dbj|BAG88071.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215692800|dbj|BAG88244.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215768136|dbj|BAH00365.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218200951|gb|EEC83378.1| hypothetical protein OsI_28791 [Oryza sativa Indica Group]
Score 1184
Evalue 7.44412e-128
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15929
gacaaaaatacTAACTGGCATTAAACAGAAatactT*CATT*CTTACACTGTTCTTTCCAaG*ATGTTTCAG*ACAAACAAAAATGACTTTCAAAACTGG
*AGCCAAACTGCCACAGTATGCTTGCACACTACTCAAGG*ATGAGGAATAGATATGGTTCAACAATGCTAAACTTAGTTCATCCGCTGCGCAGCCTCCTT
TGCGATAAGCCTTTCCCTGGCCTTGGTCTTCGCTTGCGACTTGGAGCCCATGACACCACCACCCCACTTCTTCCTAACCTCGTCGAATTTGTCGTTGAAG
TTCGCCTTAATAGCCTCAAGGATCTTGCTGAACTCAAGCTTATCCTCATTCTTCACTGTGGTCAGGCACAGAACAGAGGCAGTC*TTCTTGTGAACAATC
GATCCAAGGCGAGATTTTCCCTTGACAATGCAGTAAGGGACCTCCATTTTCCTGCAAAGAGCAGGGAGCCACACAACCAGCTCAATCGGATCAACATCAT
GAGCTATGACAACCAGCTGGGCTTTACTCTGCTCGATTAGGTAGGTAACATGGTTAAGGCCATACTTCACAACTATTGGCTTCTTGGCCTCAACAGTTTT
ACCTTCAGCTTCAGCCTGGGCCCTCTTTAGAAGCCTCTCCTTCTTGGCAACTTT*GTCTTCAGGCCGGTACTTAAGAAGCATCTTGAACAAGTTTGTTGC
AAGGTTCTTGTCGAGGGTGCGGGTGAACTGGTGGAGTGCCGGGGGCACCTTGAGGCGC*TGCTTGAGGATGCGGCGCTGGCGCTGGATGCGCACAACCTT
GGGCCACTTAACGAAGCGGTGGAGGTCCTTCTTGGGCGGGAGGGCGCCACCGATGCCGAATTGCTTCGTCCTCTTCTCGAACAGCGGGTTGGTCACCTTC
TCCGTTTTCTTCTTCGCCGGGACCGGCGCCTTGCCGCCTCGCTTAGGGGCCATTTCGCCGGCGGCTGGTTGAGGTCAGCGGGGCGACGGCGAGGGGCAGa
ccctcgtgccgaat
page-top