Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15904  (registered. 2002)
Contig Information
Length 989 bp
Clones 36 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 7
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 3
Wh_r Root 7
Wh_yf Spikelet at early flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glutathione S-transferase [Triticum aestivum] >gi|14538027|gb|AAK66773.1|AF387085_1 glutathione S-transferase [Triticum aestivum]
Score 1110
Evalue 2.67861e-119
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15904
ttttttttttgagataaatacctGGGCACAATTTATTATTAAaccagaGCACAGG*AATGCTCATTTCAGTACAAG*ATTAG*ACAGG*ATCGCAAGCAC
AAGCCTG*AACAATCAACACGAGGAGACATCACAAG*AACACACACTCGTACAGGCACACATCAGGGGGGACACACCTCGGCTTATTTCGCGACGAACGA
GCGCCAG*AAACTAAGATCATGG*CTTCATCAGCGCAGCGACCTTCTGGACGGACGGCCTCGCCAACAGGTCAGTCCACCAGGCCTTCACATGCGGGTAC
GCGTCGAACAGAGATGCGTAGGGTGTAGCCGCCAAGCACAGGGTGACAGACACATGGTTAAGGTCCGCAAGACTGAGGGAGTCTCCAGCCAGGTACTTGG
ACTTGCTCAGGTGCGCCTCGTACACTGCCAGCACGTTCTTGATCTTAACAAGGTTGTCGTCAATGACCTTCTGGTCA*GTGGCTCCCCCAAGCATAGGAT
GGATAAGGCACTCGAAGAGAATGGGGCTCAGAGCGGCGGTGTACTGATGGGCCTCCACCTCGAGCCACACATCCACCATTGCTGACTCCTTGATGTCGCC
CTCCTT*CAACAGCTCTGGC*TTGTTCTTGCGGCAC*GCATACTTGCAAATAGCACGTGATTCGAAGACGTACAAGTCACCAT*CCTGCAAAGCTGGCAC
CTGGCCAAAGGGGTTCCTGGCGAGGTGGTCGGGGCT*CTTGTGCTCGCCGGTGCC*GAAGTTGATGGGGACGAGCTCGTACTCGACGCCGGCCTCCTCCA
GCGCCGCCACGCACCTGGTGACGTTCCACGACAGGGTCGCGCCGTACAGCTTCACCGGAGCCATCTCTTCTCACTCTGCAACGCACTCGAACCTTTTTT*
CT*CTCTTCTT*CtCGGTAGGTAAAgccgctgcggatgggatgggatggagaagaccacgctcggggtctcggctaaataggcgacggc
page-top