Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15902  (registered. 2002)
Contig Information
Length 1493 bp
Clones 36 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 9
Wh_dL Crown of seedling 4
Wh_h Spike at heading date 6
Wh_oh Pistil at heading date 2
Wh_r Root 3
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative ribonucleotide reductase R2 [Oryza sativa Japonica Group] >gi|52077275|dbj|BAD46317.1| putative ribonucleotide reductase R2 [Oryza sativa Japonica Group] >gi|186920364|gb|ACC95435.1| ribonucleotide diphosphate reductase small subunit 1 [Oryza sativa Japonica Group]
Score 1642
Evalue 1.0212e-180
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15902
ggggcAGCACAagnatGTTTATTTattgngtaagncaatACCTTGATTCATTACAATACATCAGTACATCACCAATAAGAGACAGCAAAATAACAGTAAA
TAAAAACATTGTGGAGCACCCAGCACACATGTATCACCGCTACAACTACTAGGACTAGGGGGAGCAACCAGACGCGGGGGGCGA*GCGAGCGAGCGAGCT
ATTGGTAATGGAGACTGCATATCATCATCGGGCCGATCA*GAAGTCCTCGTCGATGCTGAAGACGTGCTGGGTCGCGGCGCCGCCGTTGAGGTTGGACAT
GACGGACGCCTTCTGGTACTCGCCGACGCGCTTCTCGAAGAAGTTGGTCTTGCCCTGCAGCGAGATGAGC*TCCATCCAGTCGAACGGGTTGGTGGCGTT
GTACAGCTTCTTGCAGCCCAGCGCCATGAGCAGGCGGTCGGCGACGAACTCGATGTACTGGCTCATGAGGTCGCCGTTCATGCCGACGAGCGCGCAGGGG
AGCGCGTCGCAGACGAACTCCCTCTCGATGTCCACGGCCTCGGACACGATCTCGAAGACGCGGGACTCGTCCAGCTTGCCGCGGAGGATGTCGTAGAGGA
GGCAGGCGAAGTCGCAGTGCAGGCCCTCGTCGCGGGAGATGAGCTCGTTGGAGAAGGTGAGGCCCGGCATGAGCCCGCGCTTCTTGAGCCAGAAGATGGC
GCAGAAGGAGCCCGAGAAGAAGATGCCCTCGACGCAGGCGAAGGCGACGATGCGCTCGGCGAAGCGCTCCCCGCCGTCGATCCAGCGGAGGGCCCAGTCG
GCCTTGCGGCGCACGGCGGGGATGGTGTCGATGGCGCGGAAGAGGCGGTCCTTCTCGACGTCGTCGCGGATGTAGGTCTCGATGAGCAGGGAGTACATCT
CGGAGTGGATGTTCTCGATGGCGATCTGGAAGCCGTAGAAGGCCCTGGCCTCGGCGACCTGCACGTCGGACATGAACCTGGAGGCGAGGTTCTCCAGCAC
GATGCCGTCGGAGGCGGCGAAGAAGGCGAGCACGTGGGAGATGAAGTGGCGCTCGTCGTTGGAGAGGGTGGTGTCCCAGTGGCGCGCGTCGGAGGAGAGG
TCCACCTCCTCGGCGGTCCAGAAGGACGCCACCGCCTTCTTGTAGAACTCCCAGATCTGCGGGAACCGGATGGGGAACATGGAGAAGCGGTCCGACGACT
CCGCCAGGAGCGGCTCCTCCGCGTCGCAGGCGGGCACCATGGAGAGGGCGGCAGGCATCTTCGGAATTCGGCGGCGGCGGCGGCGCTGGCCTCGAGGTGG
GAAGGATTTT*CTGCTAGGGATTTGGGAGATtggaCTGGCGGtggttgtggtgtgggggaatggagcgggggccggaggaggtttatagggtgggatcgg
gagggaagatttcgaattggaaaggatttggcggctccttggagggaaggaggagcgggcgcggtgagggcgccgcctcgtgccgaattcctc
page-top