Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15891  (registered. 2002)
Contig Information
Length 1879 bp
Clones 35 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 35
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit triticin [Triticum aestivum]
Score 2805
Evalue 0
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15891
attcggcacGAGGGTTTCGCTTCGCTCTCTTTTTACTT*CTGCATTTTGCTCTTGTGCCATAGCTCCATGGCACAACTGTTTGGCATGAGCTTTAACCCA
TGGCAAAGCTCTCGCCAAGGGGGTTTCAGAGAGTGTACATTCAATAGGCTACAAGCATCTACACCACTTCGTCAAGTGAGGTCACAAGCAGGCCTGACCG
AGTATTTTGATGAGGAAAATGAGCAATTTCGTTGTACTGGTGTATTTGCCATCCGTCGTGTAATCGAACCTCGTGGTTATTTGTTACCGCGATACCACAA
CACTCATGGATTAGTCTACATCATCCAAGGAAGTGGTTTCGCCGGACTGTCTTTTCCTGGATGCCCAGAGACATTCCAGAAACAGTTTCAAAAATATGGG
CAATCACAATCCGTACAGGGTCAAAGCCAAAGCCAAAAGTTTAAAGATGAGCACCAAAAAGTTCACCGTTTCAGACAAGGAGATGTCATTGCATTACCGG
CAGGCATTGTACATTGGTTCTACAATGACGGTGATGCGCCAATTGTGGCTATCTATGTTTTCGACGTAAACAACTATGCTAATCAACTTGAGCCTAGGCA
TAAGGAATTTTTGTTCGCTGGCAACTATAGGAGTTCGCAACTTCACTCTAGTCAAAACATATTCAGTGGTTT*CGATGTTCGATTGCTTGCTGAGGCCTT
GGGTACAAGTGGAAAAATAGCGCAAAGGCTTCAAAGTCAAAATGATGACATAATTCATGTGAATCATACCCTTAAATTTCTGAAGCCTGTTTTTACACAA
cagcgAGAGCCAGAATCCTACCCACACACTCAATATGAGgaagggcAATCTCAGGCAAAACACTCTCAGGAAGAGCAACCTCAAATGGGGCAGtcacagg
aagAGCAACCTcaaatggggcagtcacagggagagcagcctCAAATGGGGCAGTCTCAGGCAAAGCACACTCaggg*agAGCAACCTCAAATGGGGTGGT
CTCAGGCAAAGCACTCTCAGGGAGACCAGCCTGAAGAAGGGCAGGGAGGGCAATCTCAAGAAGAACAATCTCAGGCAGGGCCATATCCGGGATGTCAACC
TCATGCAGGGCAATCTCATGCATCACAATCAACTTATGGTGGTTGGAATGGTTTAGAGGAGAACTTTTGTGATCATAAGCTAAGTGTGAACATCGACGAT
CCCAGTCGTGCTGACATATACAACCCGCGTGCCGGTACGATAACCCGTCTCAACTCCC*AAACGTTCCCC*ATCCTTAACATCGTGCAAATGAGTGCTAC
AAGAG*TACATCTCTACCAGAACGCCATTATTTCACCATTATGGAACATTAATGCCCATAGTGTGATGTACATGATCCAAGGACATATCTGGGTTCAGGT
TGTCAATGACCATGGTCGAAATGTGTTCAATGACCTTCTTAGCCCGGGGCAACTATTAATCATACCACAGAACTATGTTGTTCTGAAGAAGGCACAACGT
GATGGAAGCAAGTACATTGAATTCAAGACTAATGCGAACTCCATGGTTAGTCACATCGCAGGAAAGAACTCAATTCTCGGCGCCTTGCCCGTTGATGTCA
TCGCCAATGCATACGGCATCTCTAGGACAGAAGCTCGAAGCCTCAAATTTAGCAGGGAAGAGGAGTTGGGAGTATTCGCTCCTAAATTCAGTCAAAGTAT
CTTCCGTAGTTTTCCTAACGGCGAAGAAGAGTCGTCTTAAGAGCGCATGAGATAATGTCAAAACTAGCTCATGGACTAAAATAAACACATCATTG*AGTG
TGTAGCACTTTGATGTTTCCATATATG*GTCGTCTCAATAAGATATCAACAAAGGT*CCATTGTGTTTCAaaaaaaaaa
page-top