Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15887  (registered. 2002)
Contig Information
Length 769 bp
Clones 35 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 7
Wh_dL Crown of seedling 4
Wh_e Seed DPA10 2
Wh_h Spike at heading date 1
Wh_yd Spikelet at late flowering 10
Wh_yf Spikelet at early flowering 9
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Protein H2A.7; AltName: Full=wcH2A-4; AltName: Full=wcH2A-10 >gi|536892|dbj|BAA07278.1| protein H2A [Triticum aestivum] >gi|536896|dbj|BAA07280.1| protein H2A [Triticum aestivum]
Score 444
Evalue 2.92569e-42
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15887
ttttttttttggcaagtaAGTAATCCATAGGTGCAACGTTTTATAGAACATAG*CAACGAATTACAGAGGATGTAAC*CATTGTCCACACCTAGTTTAGC
ATCGGTACAAGCACACAGATTCAGAAACTAATAGTAGTACTAACATCCTAGTAGTAGTAAAACGCAA*CACCTAGGCAACACTTAACTGAACACGCTACT
ACACAGAACTGGATACAGCCGAGCACCCACGACCTCAGAGGAGGAGTCGTCATCTAGCTATCGTCGTCGGCAGCCACGGCCTTGCTGCCTCCGGCCTTCT
TGGGGAGCAGAAGGTTGTGGATGTTGGGCATGACACCGCCGCTGGCGATTGTGACCATGCCGAGCAGGCGGGAGAGCTCCTCGTCGTTGCGGACGGCGAG
CTGGATGTGGCGCGGCACGATGCGGGTCTTCTTGTTGTCCCTCGCCGCGTTCCCGGCCAACTCCAGAACCTCAGCGGCGAGATACTCCAGCACGGCGGCG
AGGTAGACGGGGGCGCCGGCGCCGACCCTCT*CGGCGTACTTGCCGGCCTTGAGGAACCGCGCGATCCTGCCGACGGGGAACTGGAGCCCGGCCTTGGAG
CTCCTGGAGATGGCCTTCTTGGCGGCGCCCGAACCAATCG*CCTTGCCCCTTCCG*GCCATGT*CTACAGTACT*CCGAGGGGAT*CCGCGGTTGTGAAA
TGGAAAGCGAGGCGCCGGGA*GGAAGTGCGGAGGCGGTGTGGTGTgcctcgtgccgaattncctgcagc
page-top