Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15884  (registered. 2002)
Contig Information
Length 1356 bp
Clones 35 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_SL Seed DPA30 4
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 7
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 7
Wh_yf Spikelet at early flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0686800 [Oryza sativa (japonica cultivar-group)] >gi|1346109|sp|P49027|GBLP_ORYSJ Guanine nucleotide-binding protein subunit beta-like protein (GPB-LR) (RWD) >gi|540535|dbj|BAA07404.1| q group of receptor for activated C-kinase [Oryza sativa Japonica Group] >gi|113533441|dbj|BAF05824.1| Os01g0686800 [Oryza sativa (japonica cultivar-group)] >gi|125527298|gb|EAY75412.1| hypothetical protein OsI_03315 [Oryza sativa Indica Group] >gi|125571617|gb|EAZ13132.1| hypothetical protein OsJ_002957 [Oryza sativa (japonica cultivar-group)] >gi|215704365|dbj|BAG93799.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765745|dbj|BAG87442.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215768333|dbj|BAH00562.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1545
Evalue 1.59181e-169
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15884
taTTATTAGatncaCGAAATTGCAGGTCATTTGACATCATTCTTAGAAAATCCCTCGACATAACAAGCAGCAACGCTGGTTCCATGATTCACGAGACAAT
ATATTGAACAGCCAAAACCAACAAACGATGCATTATCCATGAGATCATGACTGCGGCTAAGACACAGATAGTAAATTAAGCAGAAGTACCAAGGCAGATA
TTACGCCTCAAGACAGTCAAAAAAAGAAGATACCACAGCCGTTTTACCAGAACAGAGGCCACTAAAACAAGATACATAATCTAGCTAGAGTAGCTGAACC
CCGAGATCTTGTAGATGCGGATAGTTCCATCGGTGTAACCAGCATAGAGAGTGCTGGCATCCGCGCTCCAGCTCAAGCAAGTGCAGTAGAGCATCTGCTT
CGTGGAGACAGGGACCTCGGGCCTAAGGTCCTGCACGATGTGCTTTGACTCAAGATCCCAGATCTTGATGGAATCCTGTGTCGCCGCGCAGAGCCAGTAG
CGGTTGGGCGAGAAGCAAAGTGAGTTGATAATGGATCCCGCATCCAGCGAGTAGAGTCTCTTGCCCTCGGTCAAATCCCACAGCAAGGTGACGCCATCCT
TGCCACCAGACGCGCAGAGCGAACCGTCTGGGCTGACCGCGACGGCGCTAACATAGCCACCATGACCATCAAGAGTGCAGCGGAGCTTGCAGTTGGTGAG
GTTCCAGACCTTGACGGAGCGGTCCCATGAGCCCGAGACGATGGTCGGGGCGAAGTTGTTGGGTGAGAAACGGACGCAGGACACCCAGCCAGTGTGGCCC
TCGCCGCCTCCGAGGTCACCGCCGATGGTGTACTTGCACTCACCGAGGGTGTTCCAGAGCTTGATGGTGCGGTCGCGGGACGCCGAGACGATCTGTCGGT
TGTCAATGGAGAAGGCGACGGAGAGGACGTCCTTCTCGTGGCCGACGAAGCGGCGGGTGGTGACCCCGGTGGAGAGGTCCCAGAGGCGGAGCTCGCCGTC
CCAGGAT*CCGGAGAGCGCGAACTGGCCGTCGGAGCTGAGGACGACGTCCTGGACGAAGTGGCCGTGGCCGGTGAGGCGGCGGAAGGGGACGCCGTACTC
GGAGCTGGAGTCCTGGGTGGCCTGGATGGGGTTGGTGAGGTCCCAGACGAGCAGCGACTTGTCGCGGGAGGAGGAGACGATGAAGGGCGAGTTGTCGATG
GGCGTCGCGATGGCCGTGACCACGTCGTTGTGGCCGCGCATCACGCCGGCGTACACGAGGGACTCCTGCGCTCCGGCCATGGTGGTGGGGCGGAGCGAGC
G*CTAGGGTTTTGGGGGTGCGGTGGAGGCGGCGGCCTCGTGCCGAattncctgcag
page-top