Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15878  (registered. 2002)
Contig Information
Length 607 bp
Clones 35 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 7
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 4
Wh_r Root 5
Wh_yd Spikelet at late flowering 6
Wh_yf Spikelet at early flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11539 [Oryza sativa Indica Group]
Score 403
Evalue 1.02967e-37
Total Hit Count 229
Registered year 2002
Contig Sequence     [ Download ]
>Contig15878
ttttttttttaacaagggacaaacaactcaatacagaTTAAGCAACGAGATAAGGGCCAAATCATCAGTATAACAATAAGCAACGAGATAAGGGACATAT
ATCAAGCATTCAACACAGATTAAACTCAAAACATGTTCACAATAAACCAGG*CCAAGTGACATCAAGTCTTAGCTTCCATAGCAGCAACTGAAACCAAC*
CACAGACATCCAAGAGCTAGGTAGACATGGGAAGGACACAAGTTCCAGGTAAAACTACTAGCAACATCTAGAGCTGCTTGATCTCAGCCTTCCTCTTCTG
CCACAGCCTGTCCAGGGAGCCATCAGCATCACCCTGAGCACGGACGAACCCAGAGAGAGCAAAGGTGGTGAAGCGGCCATCATAGAGGCCATTCTCATCA
ACGTGACCAATGTTGATCTGGACAGAGGCGTGGTCCTTGGCCGTGATGATCCTGTTGGTGGCCGAGCACTTCCTGGGGACGTAGAGGTCCACCATGTCAC
CCACCTCGTTCTGCATGACGGCGGCTGGAGGGGGAGTGGCACAACAACAGCGACTTGATCTCTTGGATTCGAGGAGGCGCTGCGGGAGGAGGAAGAGAAG
CTGGTgc
page-top