Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15854  (registered. 2002)
Contig Information
Length 789 bp
Clones 34 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 6
Wh_dL Crown of seedling 3
Wh_e Seed DPA10 6
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 5
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L11 [Triticum aestivum]
Score 839
Evalue 4.79832e-88
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15854
ctaatATGAAACCTGAAGATTTGATGGAATTATAGATGCAGGTCAGCCCAGCAG*ACAAGGCAAAATTGATAGTGCAACTTTGTATTCAATAAACATACG
ATTCCATG*ATCCAG*ATTAAGCTTGACTGACTTAAAGCTCTAACGACAACTCAATCACTCGAAA*GGTTACTAGCTAGCGTGGGACTTGTTCAGGATGA
CACCCTCATACTTGACCTGGAACCACTTCATGGCGTCTTCCTTGGTCACCCTTTGGTGGATCCCAACACGGGCCTTGCATCGGCGCCGGCGGGAGACGCG
GTATCCAGCTCGCTCCAGAACCACGAAGAAGTCCATACCATAGATGCCGGTTGATGGGTCATACTTCATGCCAAGATCAATGTGCTCCTGAATACCAAAC
CCAAAGCAACCAGTGTCAC*T*GAAGTTCCTCCTCAAGAGCTCGTACTCCTTCACCTTCAGCCCACTCTCGAGAAGCTGCATTGCCTTCTCACCCCTGAT
CGTCACATAGCAGGCAATCTTCTCATTACGACGAATGCCGAAAGACCTGACAGTGTACCTCGCCTTGGAGAAAACTGGCGACTGCCCGCTCAGCTGCTCC
AACACCTTGGCAGCT*CGAGTGAGG*CGATCGCCGCTCTCGCCGACGG*AGATGTTGAGGACGA*GCTTCTGCACCTTGATCTCCCGCATCGTGTTCAAC
TGTTTCTTCT*CCGTCGACATGGTGAT*C*TG*ACCGGGGAGGCCGCCGGTGGAGAGGAAGCGGAAGAGGTAGGGTTTAGCggttctgc
page-top