Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5298  (registered. 2012)
Contig Information
Length 799 bp
Clones alternative view 26 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 4
Wh_h Spike at heading date 2
Wh_PCDAM Anther at meiosis 6
Wh_SHC Shoot grown with cold treatment 4
Wh_VSCB Liquid cultured tissue 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_SP 3
WH_XA Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig5298
GCACGAGGGTTCCCCGCAACCTGTCTATCGACCCAATCTCACATCAACCGACGCCTCGTCCTCCTCTCCAGATCAGATCCCTGCCCGAGCTGGTAGCAGC
AACCAACTGTTCTGCTGCTGCAGCCTTCTTCGCCGCCAAAAGGAAAAGATGCTCTATGAAATCCACTCCCATGCCCAAATCCAAGACCTGCAGGCCCGCT
CCGATGAGCTGGGCCACTCCAATGAGCACATGGATGTGAAGCTTGTCTCTCTGGAGTCGGTGCGCATAGCGCGCGAGTCGTATGCACTCCTCTGGCCGCT
GACCAAGGAGCCGATGTCCTGGGCATGCCTGGAGCTGGATTCCCTCTCGGTCGTGGCAACCTTGTCGCTGGAAATCCAAAAGCTCGAGCATGATGTGTTA
CCCCAGCTCATGGTTCAGGAGTCCAAGCTGGAACGGGGCGCCCTGGAAGCCCTCCTAGTCATGCAGAACTCAGCAATTAAGCTCTTACATCTGGCGAAGT
GCTTTAAGGAATCCTTGGGCATATTGCAGGATCTGGTCTCATGCCGAGCCGAAGATGTGAGCATAATGTTAAATGATATTGTTCTTCATGTACTCCGAGG
TAACATTTCCTGGCTTCAGGCGCGTCTCCCGGTGCTGGCCGGGCTGGTCACCATTATGTTGGAGACCCCGGTTCGTTTCTGTGATTCTGATGAGTAGACC
TATCAGCCAGCTCGAGGCTGTTGTGAAGAGTATTTCTTAGGGGCGTGGCAAACAGTTTAGAATCAAATGTTGCGATGTATTTCTTGGACCCTCCTTTAT
page-top