Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15835  (registered. 2002)
Contig Information
Length 680 bp
Clones 33 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 9
Wh_h Spike at heading date 5
Wh_oh Pistil at heading date 7
Wh_yd Spikelet at late flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Babesia bovis T2Bo] >gi|154796873|gb|EDO06053.1| hypothetical protein BBOV_II000930 [Babesia bovis]
Score 79
Evalue 4.82805
Total Hit Count 2
Registered year 2002
Contig Sequence     [ Download ]
>Contig15835
ttttttttttaACAACACGGCTGAATATAGATCTCTGATAACAACAGATAAGAGTGGCGATAGAGTGCCCTTACATCCCACATGCAACCACCGAAATTAG
*ATCCCACAG*AACCTGGA*TCCCCATTGTACATACAGTAGTGATCTTACATAACACACAAGCCAGGAATTACAGAGTACACCG*G*CTAGTTAAAACAT
GCATGATATATA*GAGTACTAGTAGATAGTAGAACTTGCGGGTGCAGTAGTAGATAGTAGAACATGCGGTGCAGGATAGATATTCCAGTCATTCACCATT
GAGCCATCTCCCTTCAACCGAGCCTATGGACCCCAAGCAAAAAGGTGAGTGCTCCAAGACTGAAGCCAGCACCACAGGCCAAGGCCTCGTCCCTGCGCCT
CTTCCTGTGTTTCTCTACAAT*CTTGTCCAGTGCCCGGCGAAACTCTGGGCCGAAGCCGAAGCGGTCGAAGTCAGCATCAGCAGGTGCCGGAGCACGAGA
AGAGACGCGAACCCGCTGGACAGCGGCGGGGATCTTCTGCTTCAGCTTGGCGGCCATGGTGCGCAGCGCCATAGCCATACCCTCCACCAAGCCAAGCAGA
T*CTGGACGACGGCGGCTAGGGTTTCCTTCT*CTCGATCTCCAACACGCGAGCGat*cctCGTgcccgaattcctgcagc
page-top