Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15832  (registered. 2002)
Contig Information
Length 1222 bp
Clones 32 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 9
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 6
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit HvPIP1;5 [Hordeum vulgare subsp. vulgare]
Score 1457
Evalue 2.18344e-159
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15832
tttttttttTAACTTAAATCTTCCACGACAATAAGAGCACACCCAACTGTCACACTGG*AGTCTTAATACACGCGAGTCTGGATTCAGGCAGGAGATAAC
ATCTTCAGGAGATCGAGATGGATAATCGACGGCGGATGCGATACTAGGCGCTCGAAACAGGACATCACAAAGAAGCTCGTTATTCCCGATCGGCTTTCTG
TAGCAGAGGCGAGGCGGC*TTAGGACCTGCTCTTGTTGAACGGAATCGCTCTGATGATCACCTGGTGGTAGACGGCCGCCAGGGCAGCGCCCACGAAGGG
GCCCACCCAGAAGATCCAATGGTCGTTCCAGGCATGGTCCCTGTTGTAGATGATAGCAGCCCCAAGGCTCCTCGCTGGGTTGATGCCGGTGCCAGTGATG
GGG*ATGGTGGCCAGGTGGACCAGGAACACCGCGAACCCAATCGGCAGAGGGGCCAGGATAGGAACATGGGAGTCTCTGGCATT*CCTCTTGGCATCGGT
GGCCGAGAAGACGGTGTAGACCAGGACGAAGGTGCCAATGATCTCAGCACCAAGGCCGTCGCCCTTGGTGTAGCCACTGGCGACTACATTGGCGCCGCCA
CCGTTGCCCATATACAGACCCTGCTGGAAGCCCTTCACCACT*CCAGCT*CCACA*GATGGCCCCTAGGCATTGCATAATTATGTAGAAGATGGCCCTGG
TCAGGGACAGCTTCCTGGCCAAGAACAGCCCAAAAGTCACCGCTGGGTTGATGTGCCCTCCTGAGATGCCGGCGGTGCAGTAGACGAGCGCGAAGATCAT
GCCGCCGAAGGACCAGGCGATGCCCTGGACGCCGACGGTGGCGCACTTGGAGGGGGACTTGGAGACTCCCATGACGGTGAGAACGGTGACGTAGAGGAAG
AGGAAGGTGGCGATGAACTCGGCGATGCCGGCGCGGTAGAAGGACCAGGACTTGAGCTCCCCGGGCTCGAAGAGCGGCGCGGGGGGCGGCTCCTTGTAGT
CCTTGTCGTCGCCGCCGCCCTGCGCCGCCGT*CCCGATGGGCTGCCGCTCCGAGTACCTGTTGGCGCCCAGCCGCACGTCCTCCTCCTTCCCCT*CCATT
GTTCTGTCCCTCCCTTGCTCGCTGGTTGGCTGCTCCGGGAAGGGGAAGCTGAGGCAGCGGCGGCGGTGGGTGTGTTGTGAGCTGTGGGCTGTGAGGTGgt
ggaGTAGAGGCGGGTTAtaaac
page-top