Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15826  (registered. 2002)
Contig Information
Length 635 bp
Clones 32 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 8
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 2
Wh_oh Pistil at heading date 4
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Chain 6, Structure Of Signal Recognition Particle Receptor (Sr) In Complex With Signal Recognition Particle (Srp) And Ribosome Nascent Chain Complex >gi|119390383|pdb|2J37|6 Chain 6, Model Of Mammalian Srp Bound To 80s Rncs
Score 544
Evalue 4.76753e-54
Total Hit Count 418
Registered year 2002
Contig Sequence     [ Download ]
>Contig15826
ttttttttttcAAACAACAAGTCAAAACTTCAA*GCACTTGAA*CAAAATATCCAACGTCTCAAATCTTCTATCAAGAAGTCATGG*A*ACATCATGAAC
AGTAG*ATAACAATAAGCTAAAGCAAG*ACTTCCCAATATGCTCTCAGCAGATATGTATTAAATTCTAACTGATTGAAACAACAG*ACAGGGGGTTTAGT
CCTCATCCTCCACAACCTTGGTACCCAAACCTTTAAGACCTTCCTGGGGGACTTCAGCAACTGTGACCAGAGAGTACAGCTCCTCCTTAGCGTCCTCCTC
GTCGTTCCTCTTGCGGGCAATCCTGACACGGACTCTCCTCGGGACACTCCTGATGCCGCTGCTCCAGATGTGCTTGTTGAGCTTCACGTCAATGCGGACA
TCGTTGGTT*CCCATGGCCTTCTGTGCAAACTTCC*TGATCT*CCTTGATGGCATTTGGTGCCTTCTT*C*TTGAAGGTGCAT*CCATGGAGGCGCTTGT
GGAGGTTGACAGTGTACTCGCGGGTCACCACCTCGT*CCTTGCGCGGGCCGGGGGCGCGCTT*CTT*CT*CCGACATCGCCGACGGCCTCCTTTCGCCCT
GCTCCTCTCTTGGCTTCGATGGAGGCTGCGgcgag
page-top