Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15814  (registered. 2002)
Contig Information
Length 1097 bp
Clones 32 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 6
Wh_e Seed DPA10 26
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alpha gliadin [Thinopyrum ponticum x Triticum aestivum]
Score 415
Evalue 1.24633e-38
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15814
ttttttttttggaactcaaacaaacaatcatatgTAGACAAG*ACATGTGTTTGTCTTTTATTCCCATGTTTGAACTAGTATAGTTCGGGTTCTTACATG
ATACTGCATGTCACTTTATTTTTT*CACCGCTACAACGACCAAACCATGGACTAAGAAAACGG*TGTATCATATGTCTACTACTAGAGTTCTTCTCTTCT
CAGTTAGTACCGAAGAAGCCAACTGGAGCAATGGTGCAATATGGAGGGATATAGACATTGCACATTGCAGGTAGCGTCTCTAGCGCTAGGTTCCTTATTT
CCTCAAACTGGGGCAGTTGTTGAGGCTGGACAGAGCCCTGGGCCTGTGGGTTTTGCTGAGATGGCTGGAAGGAGCCCTGGCCTGATGGATATTGTTGTTG
AGGCTGTTGGAAGGAGACCTGGCTCAACGGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGATGCAGAATAA*TAGCATGAACAACATTGTG
GATGGCTT*GGCACCGC*GACTGCTCGGGGATCTGCCACAGCTGCTGACAACACAATTGTTGCACCAGCTGGTAAGTACTTTGTT*GCAAAACTTGTGAG
CTTCCATGCGCTATGCTGTGTTGTTGCAATACAACATCCCTGCATGGAATCAGTTGTTGTTGCAAAATTTGTTGAAGGATCTGTTGTTGTTGTTGTTGTT
GTTGTTGTTGCTGCTGCTGCGAAATTGGTTGTTGTGGTTGCGAATACTGTGGTTGCGGTTGTGGATATGGTTGTTGTGGTCGAAATGGTTGCGGCTGCGG
ATATGGTAGATGCGGCTGCGGATATGGTAGTTGCGGCTGCGGAAATGGCTGCAGCTGCAGATATGGTTGTTGTGATGGAAATGGTTGCGGCTGCGGATAT
GGCTGTTGTGGTGGAAATGGTTGTTGCTGCCCTGGAAATTGTTGTTGTTGTACCAATGGAACTTGCTCTTGTGGTTGTTGCTGAGATGGATTTTGTGGCT
GCAATTGTGGCACTGGAACTCTAACTGCAATTGTGGCGGTG*GTTGCTACAATAGCAAGGAGTGCAAGG*ATGAGAAAGGTCTTCA*ggggatttgt
page-top