Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15812  (registered. 2002)
Contig Information
Length 1656 bp
Clones 32 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_SL Seed DPA30 11
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit DnaJ-like protein [Solanum tuberosum]
Score 1251
Evalue 1.21393e-176
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15812
ttcGGCACGagggcCCGACTTTGACCGCCTCCTCGTCTCCGCTCCCACGCCCGCGGG*AG*AGAGGCGACCGGCGGCGGCGCGCGAGG*AGGGGCCTACC
CACCCATCCCACCACCCCGCCGGCGAAGATGTTCGGCCGCGCCCCCAAGAAGAGCGACAACACCAAGTACTACGAGGTGCTCGGGGTGCCCAAGAACGCC
GCCCAGG*ACGACCTCAAGAAGGCCTACCGCAAGGCCGCCATCAAGAACCACCCCGACAAGGGCGGAGACCCCGAGAAGTTCAAGGAGCTGGCACAAGCC
TATGAGGTTTTGAGTGACCCTGAGAAGCGTGAGATCTATGATCAGTATGGCGAAGATGCTCTCAAGGAAGGAATGGGTGGAGGAGGAGGTGGTGGGA*GT
T*GATCCATTTGACATCTTCTCATCATTTTTCGGGCCCTCTTTTGGAGGTGGTGGTGGCGGCAGCA*GCAGGGGCA*G*AAGGCAA*AGG*AGGGGAGAG
GATGTTGTCCATCCACTTAAAGCTTCTCTAGAAGATCTTTACAATGGTACCTCGAAGAAGCTCTCTCTTTCCCGTAGTGTCCTCTGCTCCAAGTGCAAGG
GCAAGGGATCCAAGTCTGGTGCTTCCATGAGGTGCCCAGGTTGCCAGGGGTCAG*GCATGAAAGTCACTATTCGTCAGCTGGGGCCTTCCATGATACAGC
AGATGCAGCAGGCCTGCAATGATTGCAAGGGCACCGGGGAGAGTATTAACGACAAGGATCGCTGCCCAGGCTGCAAGGGTGAGAAGGTTCTTCAGGAGAA
GAAAGTTCTGGAGGTTCACGTTGAGAAGGGGATGCAACACAACCAGAAGATCACCTTCCC*TGGTGAAGCTGATGAGGCGCCTGACACTGTTACTGGAGA
CATTGTATTTGTCGTCCAGCAGAAGGAACACCCGAAGTTCAAGAGAAAGGGCGATGATCTCTTCTATGAGCATACCATATCTCTCACTGAAGCTCTTTGT
GGGTTCCAACTCGTCC*TGACCCATCTGGACAACAGGCAGCTGCTCATTAAATCAAACCCTGGTGAA*GTTGTCAAGCCTGATTCATTCAAGGCAATCAG
CGACGAGGGGATGCCGATGTACCAGAGGCCTTTCATGAAGGGCAAGCTCTACATTCATTTCACGGTGGAGTTTCCCGACTCGCTGGCACCGGATCAGTGC
AAGGCTCTCGAGGCTGTGCTTCCACCAAAGCCTGCATCCAAGCTGACCGACATGGAGCTCGATGAATGCGAGGAGACGACAATGCATGACGTCAACATGG
AGGAGGAGATGCGTCGGAAAGCCCATGCTGCTGCTCAGGAGGCGTACGATGAGGACGACGAGATGCCTGGAGGCGGTGCCCAAAGAGTGCAGTGCGCACA
ACAGTAAGATAGGTTGGGCAGCAAGCTTTTTTGGGACCCAAGATCAAGATGCCTGCCCGCTCTTTGGGGTTTTGGCGGTGTTATCGATGAAGCTGATTTT
TGCCCGTATGGCGCCGGgcgCTGTATCCATGTCTTTTGAAAAATGCTACGTGGCTACTCTTAATGTAGTGTGATACTCGTATAAAAGCAATCTGTTTGTG
AAAACTAACGCACGCTGTCTGTCTGTCTCtcnaatacgttgtactAAGCAGtaccg
page-top