Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15801  (registered. 2002)
Contig Information
Length 906 bp
Clones 31 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 13
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit translation initiation factor IF-2 [Acidothermus cellulolyticus 11B] >gi|166226241|sp|A0LV27|IF2_ACIC1 RecName: Full=Translation initiation factor IF-2 >gi|117649185|gb|ABK53287.1| bacterial translation initiation factor 2 (bIF-2) [Acidothermus cellulolyticus 11B]
Score 98
Evalue 0.0529707
Total Hit Count 105
Registered year 2002
Contig Sequence     [ Download ]
>Contig15801
ttttttttttgAACGAGAGTTGGGTCCCGAAGGACCCAGAACCTGCGTTAATTCTTAAACGGTGATAGTACAAAGCAG*ATTACAACAGGACCCAAACAT
AAACGGAAACTACCACTAGGTCCCTGGTTTTTGCATGGAGGACCCCAAACAGGAAATAAGAAACTCAATCGGGTCCTAATCAACTCTGGAACAGAACCAA
TCCC*GTCGCCGCCGGGGACGCTACCACTTGGTGCGCCGGGATCTCCACAGCCGCTCCATCCGCTACCATTAGAAGAAGCTGGGGACTCCAAACCAGAGA
TGAACTGCCTCCCTTCAAGGCTCCAGGCCGGGAGGAAGATAGATGGCCGCCCTTCGGCCAGCAAGGTCAATGGCGAGATGAGGGCCGGCAGCCGACCGCT
GAGCTGGCGCCGAAGCCCTGATACATAAGCCATTGAGAATGAGCTCTTACCCAATCCGTGAGATCCAGTTCGCTGCTTCTCATCCTCGCTCCATCCGTCT
*CCATGGCGGCAACAGAGGAAGGAGACAAGCAGCCGCCCCCCACCAACACAGAGAAGACGACGAGCTTATTGAAGGAGTCGCC*GGCGTCGCTCTCTCCG
ATTGCACGCAGCACCTCACCGCCACAACCATGATGAACGACACCGCTAGCCACCGGGCGCAGCT*CGCGTGCGCCGGCGGCGCGCTACGCCACGGCATAA
CGCCAGACTCCACTACGGGAAGACTCAACCAAGAACTAGCTGGATTATATACAAAGCTCCACGCACCTCTCCCTCCTCTCTTCCGGCCAGCATAGCCGCC
GTCGGAGATTGGGGATCGGGCGGGATCAGGTGGCCTCGCTGCGACTCTCAACAAGAACTCTCTCGAGGGCCCTTGTGGATTAGTGGCGTTCtcCCTCGTG
CCGAat
page-top