Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15784  (registered. 2002)
Contig Information
Length 841 bp
Clones 31 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 8
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L36 [Triticum aestivum]
Score 492
Evalue 9.55973e-48
Total Hit Count 280
Registered year 2002
Contig Sequence     [ Download ]
>Contig15784
gcGGCGGAGTAGGGTTTCACCTGCATCCATTCTCAACGTTAGCAGGAGCGAGTGGG*AGTCCGGCCATGGCGCCGTCGCAGCCCAAGTCAGGGCTCTTCG
TGGGCATCAACAAGGGCCACGTCGTCACCAAG*CGCGAGCTGCCGCCACGCCCG*TCCGACCGCAAGGGGAAAGGTACCAAGAGGGTGCATTTTGTCAGG
AACTTGATTAGGGAGGTTGCTGGATTCGCTCCCTATGAGAAACGTATCACTGAGCTTCTTAAGGTTGGAAAGGACAAGCGTGCACTCAAGGTCGCCAAGA
GAAAGCTTGGTACTCACAAGAGAGCAAAGAAGAAGAGAGAGGAGATGTCAAGTGTCCTTAGGAAGATGAGGTCTGCTGGTGGTGGTGGTGCTGGTGACAA
GAAGAAATAGAGCGTGGCTAGTTGGTGAATTTTATCCGAAAACTCGGTCCTGTATTACCAG*TCCGTACCTATAGAGCTATGGCCATTGTGTTGGATTTT
GGAAC*TATTAAATTTGACGCTCTTAAGCCCGTGGTTTCTATTCTGAGAAGACCAATCTTTTTAAGATTTTTAGTTTGGTGCCTTTGTTTTATTATTACT
TGCTTTGTTTGATTACTTGGCACAAAGCTGTTTATTGCAATTATGTAGCGTGTCTGGGTTTTGTACCTGCGATTGTTGTATGTTTTCAGTAGGTGAATTG
CTATAAGAAGCCCTGCCACGGTGTGGTCTTGGATCCCATATCCCCATTACAGCATCCATGTCTGGCATAATATcttgatTTACCAATTGTCAACTGTata
gcatctattaatagcgccttccnagtacaaaacatcttcat
page-top