Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig15776  (registered. 2002)
Contig Information
Length 635 bp
Clones 30 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_dL Crown of seedling 9
Wh_e Seed DPA10 1
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 6
Wh_yd Spikelet at late flowering 4
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0234200 [Oryza sativa (japonica cultivar-group)] >gi|303857|dbj|BAA02154.1| ubiquitin/ribosomal polyprotein [Oryza sativa Japonica Group] >gi|13358806|dbj|BAB33149.1| ubiquitin fused to ribosomal protein L40 [Oryza sativa] >gi|13358808|dbj|BAB33150.1| ubiquitin fused to ribosomal protein L40 [Oryza sativa] >gi|52077170|dbj|BAD46215.1| ubiquitin / ribosomal protein CEP52 [Oryza sativa Japonica Group] >gi|108707030|gb|ABF94825.1| ubiquitin fusion protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113547950|dbj|BAF11393.1| Os03g0234200 [Oryza sativa (japonica cultivar-group)] >gi|125606687|gb|EAZ45723.1| hypothetical protein OsJ_029206 [Oryza sativa (japonica cultivar-group)] >gi|218202661|gb|EEC85088.1| hypothetical protein OsI_32449 [Oryza sativa Indica Group]
Score 663
Evalue 7.97501e-68
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig15776
ttttttttttgAACGCAgaacaAACAGAGGAGATACGGCAAAATTATAGGTTTGCTACCATATACCAATACTGTCAATTATCATCACCACAACGATTGG*
AGGCTGAAAGCAAAGTAAAATAAGGTTCAACGACAACGAGACGACAATAGCATAAACGCTAACACAGCA*ATGGATTCAACCGGTCCATGAAACTGACTA
GTAGCACTCTAGTTCTTGATCTTCTTCTTGGGCCTCAGCTGGTTGCTGTGGCCACACTTCTTCTTGCGGCAGTTGACAGCCCTTGGGTGCAGGCGCGCGT
AGCATTTGCGGCAGATCATCTTCTCCTGGTTGTACTTGCGGGCAAGAGCCTGCAGGGATGGCTCGATGATGCCTCCGCGGAGCCTGAGGACGAGATGGAG
GGTCGACTCCTTCTGGATGTTGTAGTCGGCAAGGGTGCGGCCGTCCTCCAACTGCTTGCCGGCGAAGATCAGCCGCTGCTGGTCCGGCGGGATCCCCT*C
CTTGTCCTGGAT*CTTGGCC*TTGACATTGTCGATGGTATCGCTGCTCTCAACCTCGAGGGTGATGGTCTTCCCCGTGAGGGTCTTGACGAAGATCTGCa
tttttctctctctctctctctctctctctctctct
page-top